Skip to main content

sgrna_designer

Python library to design sgRNAs for CRISPR tiling screens

The primary function of this package is design_sgrna_tiling_library, in which you can input a list of ensembl transcript IDs, specify a region of interest (e.g. three_prime_UTR) and get all sgRNAs tiling those transcript regions.

Install

pip install git+https://github.com/gpp-rnd/sgrna_designer.git#egg=sgrna_designer

An example

In this example we'll design sgRNAs tiling the 3' UTR of PDL1 (CD274) and BRAF

Note: You must also have pandas installed to run this tutorial

from sgrna_designer.design import design_sgrna_tiling_library

target_transcripts = ['ENST00000381577', 'ENST00000644969'] # [PDL1, BRAF]

Note the design function is agnostic to CRISPR enzyme and pam preferences, so you must specifiy the following parameters in a design run:

  • region: broad region you are trying to target (e.g. UTR)
  • region: more specific region you are trying to target (e.g. three_prime_UTR)
  • expand_3prime: amount to expand region in 3' direction
  • expand_5prime: amount to expand region in 5' direction
  • context_len: length of context sequence
  • pam_start: position of PAM start relative to the context sequence
  • pam_len: length of PAM
  • sgrna_start: position of sgRNA relative to context sequence
  • sgrna_len: length of sgRNA sequence
  • pams: PAMs to target
  • sg_positions: positions within the sgRNA to annotate and target (e.g. [4,8] for nucleotides 4 and 8 of the sgRNA for a base editing window)
sgrna_designs = design_sgrna_tiling_library(target_transcripts, region_parent='UTR',
                                            region='three_prime_UTR', expand_3prime=30,
                                            expand_5prime=30, context_len=30, pam_start=-6,
                                            pam_len=3, sgrna_start=4, sgrna_len=20,
                                            pams=['AGG', 'CGG', 'TGG', 'GGG'],
                                            sg_positions=[4, 8], flag_seqs=['TTTT', 'CGTCTC', 'GAGACG'],
                                            flag_seqs_start=['TCTC', 'AGACG'], flag_seqs_end=['GAGAC'])
sgrna_designs
<style scoped> .dataframe tbody tr th:only-of-type { vertical-align: middle; }
.dataframe tbody tr th {
    vertical-align: top;
}

.dataframe thead th {
    text-align: right;
}
</style>
context_sequence pam_sequence sgrna_sequence sgrna_global_start sgrna_global_4 sgrna_global_8 sgrna_strand object_type transcript_strand transcript_id chromosome region_id region_start region_end
0 CATTGGAACTTCTGATCTTCAAGCAGGGAT AGG GGAACTTCTGATCTTCAAGC 5467872 5467875 5467879 1 three_prime_UTR 1 ENST00000381577 9 ENST00000381577 5467863 5470554
1 ATTGGAACTTCTGATCTTCAAGCAGGGATT GGG GAACTTCTGATCTTCAAGCA 5467873 5467876 5467880 1 three_prime_UTR 1 ENST00000381577 9 ENST00000381577 5467863 5470554
2 CTTCAAGCAGGGATTCTCAACCTGTGGTTT TGG AAGCAGGGATTCTCAACCTG 5467888 5467891 5467895 1 three_prime_UTR 1 ENST00000381577 9 ENST00000381577 5467863 5470554
3 GCAGGGATTCTCAACCTGTGGTTTAGGGGT AGG GGATTCTCAACCTGTGGTTT 5467894 5467897 5467901 1 three_prime_UTR 1 ENST00000381577 9 ENST00000381577 5467863 5470554
4 CAGGGATTCTCAACCTGTGGTTTAGGGGTT GGG GATTCTCAACCTGTGGTTTA 5467895 5467898 5467902 1 three_prime_UTR 1 ENST00000381577 9 ENST00000381577 5467863 5470554
... ... ... ... ... ... ... ... ... ... ... ... ... ... ...
845 GCTCAGGTCCCTTCATTTGTACTTTGGAGT TGG AGGTCCCTTCATTTGTACTT 140719570 140719567 140719563 -1 three_prime_UTR -1 ENST00000644969 7 ENST00000644969 140719337 140726493
846 TATAACAGAAAATATTGTTCAGTTTGGATA TGG ACAGAAAATATTGTTCAGTT 140719522 140719519 140719515 -1 three_prime_UTR -1 ENST00000644969 7 ENST00000644969 140719337 140726493
847 ATTGTTCAGTTTGGATAGAAAGCATGGAGA TGG TTCAGTTTGGATAGAAAGCA 140719509 140719506 140719502 -1 three_prime_UTR -1 ENST00000644969 7 ENST00000644969 140719337 140726493
848 TATTTAAAAACTGTATTATATAAAAGGCAA AGG TAAAAACTGTATTATATAAA 140719426 140719423 140719419 -1 three_prime_UTR -1 ENST00000644969 7 ENST00000644969 140719337 140726493
849 CTGCTATAATAAAGATTGACTGCATGGAGA TGG TATAATAAAGATTGACTGCA 140719360 140719357 140719353 -1 three_prime_UTR -1 ENST00000644969 7 ENST00000644969 140719337 140726493

850 rows × 14 columns

Release files for sgrna-designer 0.0.2

For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.

Source distribution (sdist)

Source distribution for sgrna-designer 0.0.2
File Size Uploaded
sgrna_designer-0.0.2.tar.gz 15.7 kB Details

Built distribution (wheel)

Table of built distributions (wheels) for sgrna-designer 0.0.2
File Interpreter ABI Platform
sgrna_designer-0.0.2-py3-none-any.whl Python 3 none any Details

Total release size: 30.0 kB

Release files / sgrna_designer-0.0.2.tar.gz

Download URL sgrna_designer-0.0.2.tar.gz
Size 15.7 kB
Tags Source
SHA-256 checksum
How to use checksums
a620a10f1be92a4d7c7341d59e046c1e93dc48ec601f4b5443bf01367bbdf792
BLAKE2b-256 checksum
How to use checksums
46b9f596cf7719a930209ede8409343f9efbfc550642ed4b6c4c8ad4db60dfdd
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/3.3.0 pkginfo/1.7.0 requests/2.22.0 setuptools/45.1.0 requests-toolbelt/0.9.1 tqdm/4.56.2 CPython/3.6.8

Release files / sgrna_designer-0.0.2-py3-none-any.whl

Download URL sgrna_designer-0.0.2-py3-none-any.whl
Size 14.3 kB
Tags Python 3
SHA-256 checksum
How to use checksums
b10eb39e2fb7d3a5c16d86baed81c76d428ba5c64fa6611a58c2107beecaf5db
BLAKE2b-256 checksum
How to use checksums
205b81f7a607fe5bef721aab0b6d937a49f8cd85c4c6dc8548bab0fc90058758
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
No
Uploaded via twine/3.3.0 pkginfo/1.7.0 requests/2.22.0 setuptools/45.1.0 requests-toolbelt/0.9.1 tqdm/4.56.2 CPython/3.6.8

Release history Release notifications | RSS feed

This release

0.0.2 This release

2 release files

0.0.1

2 release files

Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page