sgrna-designer 0.0.2

Python library to design sgRNA oligos

sgrna_designer

Python library to design sgRNAs for CRISPR tiling screens

The primary function of this package is design_sgrna_tiling_library, in which you can input a list of ensembl transcript IDs, specify a region of interest (e.g. three_prime_UTR) and get all sgRNAs tiling those transcript regions.

Install

pip install git+https://github.com/gpp-rnd/sgrna_designer.git#egg=sgrna_designer

An example

In this example we'll design sgRNAs tiling the 3' UTR of PDL1 (CD274) and BRAF

Note: You must also have pandas installed to run this tutorial

from sgrna_designer.design import design_sgrna_tiling_library

target_transcripts = ['ENST00000381577', 'ENST00000644969'] # [PDL1, BRAF]

Note the design function is agnostic to CRISPR enzyme and pam preferences, so you must specifiy the following parameters in a design run:

• region: broad region you are trying to target (e.g. UTR)
• region: more specific region you are trying to target (e.g. three_prime_UTR)
• expand_3prime: amount to expand region in 3' direction
• expand_5prime: amount to expand region in 5' direction
• context_len: length of context sequence
• pam_start: position of PAM start relative to the context sequence
• pam_len: length of PAM
• sgrna_start: position of sgRNA relative to context sequence
• sgrna_len: length of sgRNA sequence
• pams: PAMs to target
• sg_positions: positions within the sgRNA to annotate and target (e.g. [4,8] for nucleotides 4 and 8 of the sgRNA for a base editing window)

sgrna_designs = design_sgrna_tiling_library(target_transcripts, region_parent='UTR',
                                            region='three_prime_UTR', expand_3prime=30,
                                            expand_5prime=30, context_len=30, pam_start=-6,
                                            pam_len=3, sgrna_start=4, sgrna_len=20,
                                            pams=['AGG', 'CGG', 'TGG', 'GGG'],
                                            sg_positions=[4, 8], flag_seqs=['TTTT', 'CGTCTC', 'GAGACG'],
                                            flag_seqs_start=['TCTC', 'AGACG'], flag_seqs_end=['GAGAC'])
sgrna_designs

<style scoped> .dataframe tbody tr th:only-of-type { vertical-align: middle; }

.dataframe tbody tr th {
    vertical-align: top;
}

.dataframe thead th {
    text-align: right;
}

</style>

	context_sequence	pam_sequence	sgrna_sequence	sgrna_global_start	sgrna_global_4	sgrna_global_8	sgrna_strand	object_type	transcript_strand	transcript_id	chromosome	region_id	region_start	region_end
0	CATTGGAACTTCTGATCTTCAAGCAGGGAT	AGG	GGAACTTCTGATCTTCAAGC	5467872	5467875	5467879	1	three_prime_UTR	1	ENST00000381577	9	ENST00000381577	5467863	5470554
1	ATTGGAACTTCTGATCTTCAAGCAGGGATT	GGG	GAACTTCTGATCTTCAAGCA	5467873	5467876	5467880	1	three_prime_UTR	1	ENST00000381577	9	ENST00000381577	5467863	5470554
2	CTTCAAGCAGGGATTCTCAACCTGTGGTTT	TGG	AAGCAGGGATTCTCAACCTG	5467888	5467891	5467895	1	three_prime_UTR	1	ENST00000381577	9	ENST00000381577	5467863	5470554
3	GCAGGGATTCTCAACCTGTGGTTTAGGGGT	AGG	GGATTCTCAACCTGTGGTTT	5467894	5467897	5467901	1	three_prime_UTR	1	ENST00000381577	9	ENST00000381577	5467863	5470554
4	CAGGGATTCTCAACCTGTGGTTTAGGGGTT	GGG	GATTCTCAACCTGTGGTTTA	5467895	5467898	5467902	1	three_prime_UTR	1	ENST00000381577	9	ENST00000381577	5467863	5470554
...	...	...	...	...	...	...	...	...	...	...	...	...	...	...
845	GCTCAGGTCCCTTCATTTGTACTTTGGAGT	TGG	AGGTCCCTTCATTTGTACTT	140719570	140719567	140719563	-1	three_prime_UTR	-1	ENST00000644969	7	ENST00000644969	140719337	140726493
846	TATAACAGAAAATATTGTTCAGTTTGGATA	TGG	ACAGAAAATATTGTTCAGTT	140719522	140719519	140719515	-1	three_prime_UTR	-1	ENST00000644969	7	ENST00000644969	140719337	140726493
847	ATTGTTCAGTTTGGATAGAAAGCATGGAGA	TGG	TTCAGTTTGGATAGAAAGCA	140719509	140719506	140719502	-1	three_prime_UTR	-1	ENST00000644969	7	ENST00000644969	140719337	140726493
848	TATTTAAAAACTGTATTATATAAAAGGCAA	AGG	TAAAAACTGTATTATATAAA	140719426	140719423	140719419	-1	three_prime_UTR	-1	ENST00000644969	7	ENST00000644969	140719337	140726493
849	CTGCTATAATAAAGATTGACTGCATGGAGA	TGG	TATAATAAAGATTGACTGCA	140719360	140719357	140719353	-1	three_prime_UTR	-1	ENST00000644969	7	ENST00000644969	140719337	140726493

850 rows × 14 columns