Skip to main content

Synthetic data generator for snail mutation survey

Project description

Snailz

snail logo

snailz is a synthetic data generator that models a study of snails in the Pacific Northwest which are growing to unusual size as a result of exposure to pollution. The package can generate fully-reproducible datasets of varying sizes and with varying statistical properties, and is intended primarily for classroom use. For example, an instructor can give each learner a unique dataset to analyze, while learners can test their analysis pipelines using datasets they generate themselves. snailz can also be used to teach good software development practices: it is well structured, well tested, and uses modern Python tools.

The Story

Years ago, logging companies dumped toxic waste in a remote region of Vancouver Island. As the containers leaked and the pollution spread, some of the tree snails in the region began growing unusually large. Your team is now collecting and analyzing specimens from affected regions to determine if a mutant gene makes snails more susceptible to the pollution.

Each genomic assay is performed by putting samples of a snail's tissue into some small wells in a plastic microplate. An inert material is placed in other wells as a control; the wells are then treated with chemicals and photographed, and the brightness of each well shows how reactive the material was.

snailz generates several related sets of data:

Persons : The scientists conducting the study. Persons are included in the dataset to simulate operator bias, i.e., the tendency for different people to perform experiments in slightly different ways.

Machines : The equipment used to analyze the samples. Like persons, they are included to enable simulation of bias.

Specimens : The snails collected from the sites. The data records a short fragment of the specimen's genome. its mass, and when and where it was collected.

Assays : The chemical analysis of the snails' genomes. Each assay is stored in two files: a design file showing which wells contain samples and controls, and a readings file with the measured responses. The images that the readings are taken from are also stored.

Usage

  1. pip install snailz (or the equivalent command for your Python environment).
  2. snailz --help to see available commands.

To generate example data in a fresh directory:

# Create and activate Python virtual environment
$ uv venv
$ source .venv/bin/activate

# Install snailz and dependencies
$ uv pip install snailz

# Write default parameter values to the ./params.json file
$ snailz params --defaults > params.json

# Generate all output files in the ./data directory
$ snailz data --params params.json --outdir data

Parameters

snailz reads controlling parameters from a JSON file, and can generate a file with default parameter values as a starting point. The parameters, their meanings, and their properties are:

Group Name Purpose Default
overall rng_seed random number generation seed 123456
lab_params num_machines number of lab machines used for assays 5
num_persons number of lab staff doing assays 5
locale locale used for generating staff names et_EE
assays_per_specimen number of assays done per specimen 2
assays_params plate_size XY dimensions of assay plates 4
mean_control mean plate reading for control wells 0.0
mean_normal mean plate reading for normal specimens 2.0
mean_mutant mean plate reading for mutant specimens 5.0
reading_noise noise applied to plate readings 0.5
image_noise pixel noise applied to plate images 3
specimen_params mass_mean mean specimen mass 10.0
mass_sd relative standard deviation of masses 1.0
genome_length number of bases in specimen genomes 20
mut_mass_scale scaling factor for mutant specimen masses 2.0
mut_frac fraction of specimens with significant mutation 0.2
mut_prob probability of non-significant mutations per base 0.0
start_date start date of specimen sampling 2025-04-01
end_date end date of specimen sampling 2025-04-30
survey_params grid_size XY dimensions of survey grids 15
num_sites number of survey sites 3
num_specimens average number of specimens per site 10

Notes:

  1. The pollution values in survey grids are generated by performing a random walk of the grid, adding one to each cell's value each time it is visited. The random walk starts when the polluted region reaches the boundary of the survey grid.

  2. All snail genome fragments are the same length, and are generated by mutating the bases at a few randomly-chosen locations. One of those locations and one of the variant bases is selected at random as significant; a snail with that mutant base in that location is a mutant of unusual size.

Data Dictionary

All of the generated data is stored in CSV files.

Persons

persons.csv contains information about the scientists performing the study. The file looks like this:

id personal family
P06 Artur Aasmäe
P07 Katrin Kool

and its fields are:

Field Purpose Properties
id identifier text, unique, required
personal personal name text, required
family family name text, required

Machines

machines.csv contains information about the machines used in the study. The file looks like this:

id name
M01 Aero Probe
M02 Nano Counter

and its fields are:

Field Purpose Properties
id identifier text, unique, required
name machine name text, required

Note that the systematic variation in readings introduced by different machines is not stored in the generated data.

Grids

The pollution readings for each survey grid are stored in a file Gnn.csv (e.g., G03.csv). These CSV files do not have column headers; instead, each contains a square integer matrix of pollution readings. A typical file is:

0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,1,1,0,0,0,0
0,0,0,0,0,0,0,0,1,2,1,0,0,0,0
0,0,0,0,0,0,0,0,2,1,0,0,0,0,0
0,0,0,0,0,0,0,1,2,0,0,0,0,0,0
0,0,0,0,0,0,0,1,2,1,0,0,0,0,0
0,0,0,0,0,0,0,0,1,2,0,0,0,0,0
0,0,0,0,0,0,0,2,2,1,0,0,0,0,0
0,0,0,0,0,0,0,1,3,0,0,0,0,0,0
0,0,0,0,0,0,0,1,3,1,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0

Specimens

specimens.csv holds information about individual snails in CSV format (with column headers). The file looks like this:

id genome mass grid x y sampled
S0001 GCAACCGGACCGCCGTAAGG 3.82 G01 5 2 2025-04-22
S0002 TCATACGGACCGCCGTAAGG 3.53 G02 3 7 2025-04-19

and its fields are:

Field Purpose Properties
id specimen identifier text, unique, required
genome base sequence text, required
mass snail weight in grams real, required
grid sample grid ID text, required
x sample X coordinate integer, required
y sample Y coordinate integer, required
sampled date specimen was taken date, required

Assays

Summary information about all assays is stored in assay_summary.csv. The file looks like this:

id specimen machine person row col treatment reading
A0001 S0001 M00 P03 1 A C 0.56
A0001 S0001 M00 P03 2 A C 1.16

and its fields are:

Field Purpose Properties
id assay identifier text, required
specimen specimen identifier text, required
machine machine used text, required
person scientist identifier text, required
row assay plate row integer, required
col assay plate column text, required
treatment control "C" or specimen "S" text, required
reading well reading real, required

The directory also contains four files for each assay:

  1. a design file Annnn_treatments.csv showing whether specimen samples or control material was placed in each well of the assay plate;

  2. a readings file Annnn_readings.csv with the readings from each well;

  3. a "raw" readings file Annnn_raw.csv with the raw readings from each well; and

  4. an image file nnnn.png showing the image that the readings were taken from.

Each CSV file contains a multi-line header with metadata followed by a table of well values with row and column labels. A typical treatments file is:

id,A0001
specimen,S0001
machine,M00
person,P03
,A,B,C,D
1,0.56,2.22,2.17,0.55
2,1.16,2.33,2.18,0.11
3,0.35,2.13,2.82,0.08
4,1.38,1.74,2.2,1.0

while a typical readings file is:

id,A0001
specimen,S0001
machine,M00
person,P03
,A,B,C,D
1,C,S,S,C
2,C,S,S,C
3,C,S,S,C
4,S,S,S,S

The first four rows of each file are:

Field Purpose Properties
id assay identifier text, required
specimen specimen identifier text, required
machine machine identifier text
person scientist identifier text

The "raw" files are copies of the readings files with deliberate formatting errors, and can be used to teach students how to deal with realistic data.

Colophon

snailz was inspired by the Palmer Penguins dataset and by conversations with Rohan Alexander about his book Telling Stories with Data.

The snail logo was created by sunar.ko.

My thanks to everyone who built the tools this project relies on, including:

  • mkdocs for documentation.
  • pydantic for storing and validating data (including parameters).
  • pytest, pyfakefs, and faker for testing.
  • ruff for checking the code.
  • uv for managing packages and the virtual environment.

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

snailz-2.2.0.tar.gz (742.9 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

snailz-2.2.0-py3-none-any.whl (18.3 kB view details)

Uploaded Python 3

File details

Details for the file snailz-2.2.0.tar.gz.

File metadata

  • Download URL: snailz-2.2.0.tar.gz
  • Upload date:
  • Size: 742.9 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.1.0 CPython/3.12.6

File hashes

Hashes for snailz-2.2.0.tar.gz
Algorithm Hash digest
SHA256 f1614948978996a900ce000a0da4001cb4c713baad557d566a808ec157eb21ec
MD5 5e575f6ea9f745090e547a66d961c86e
BLAKE2b-256 7455a8337542ad36e34989ae586ca13114f0ace81e8934a744c3ff0dd038ce88

See more details on using hashes here.

File details

Details for the file snailz-2.2.0-py3-none-any.whl.

File metadata

  • Download URL: snailz-2.2.0-py3-none-any.whl
  • Upload date:
  • Size: 18.3 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/6.1.0 CPython/3.12.6

File hashes

Hashes for snailz-2.2.0-py3-none-any.whl
Algorithm Hash digest
SHA256 940f92dd4112a3625814707ab39fe904dcf117474aebd1d6d42e65ae5b74349c
MD5 c06a95dd9dd4dc1a4a48ef04fc5e78a9
BLAKE2b-256 22e5df96860cf68e8b332b022e22003353871fb644a5f8e82d61b86682266a1c

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page