Pairwise distance calculation and neighborhood enrichment analysis of TCR repertoires
Project description
Detection of antigen-driven convergent T-cell responses
The snetcr library allows for statistical quantification of TCR sequence similarity through enrichment analysis of sequence neighbor counts. snetcr builds on the concept of TCR neighborhoods introduced in Mayer-Blackwell et al. (2021), eLife. The library makes use of efficient vectorization in order to compute neighbor distributions. In addition it uses a novel strategy for generating TCR repertoire backgrounds that match important properties of the input repertoire such as V/J gene frequency, CDR3 length and non-templated nucleotide insertion in the CDR3.
Installation
snetcr is available as a pypi package. To install the package, simply run:
pip install snetcr
⚠️ Note: Make sure you have Fortran compiler like
gfortran, which is necessary for running certain dependencies of the software.
Use
Command line interface
By far the easiest way to run the analysis is through the using of the command line interface.
usage: snetcr [-h] [-f FILENAME] [-d DIRECTORY] [-r RADIUS] [-q RATIO] [-c CHAIN] [-s SPECIES] [-x SUFFIX] -o OUTDIR [--custom_background CUSTOM_BACKGROUND] [--custom_index CUSTOM_INDEX] [--downsample DOWNSAMPLE]
optional arguments:
-h, --help show this help message and exit
-f FILENAME, --filename FILENAME
Path to the file that contains the repertoire of interest. When analyzing multiple files at once, please use the 'directory' argument.
-d DIRECTORY, --directory DIRECTORY
Path to the directory that contains the repertoires of interest. When analyzing a single file, please use the 'filename' argument.
-r RADIUS, --radius RADIUS
The radius for defining neighbors. Default is 12.5.
-q RATIO, --ratio RATIO
The ratio between background and foreground. Only applicable when no custom background is provided. Default is 10.
-c CHAIN, --chain CHAIN
TCR chain. AB for alphabeta. Default is B.
-s SPECIES, --species SPECIES
Species. Default is human.
-x SUFFIX, --suffix SUFFIX
A suffix to add to the output file name.
-o OUTDIR, --outdir OUTDIR
Path to directory where results will be saved. If directory is non-existent, a new one will be created.
--custom_background CUSTOM_BACKGROUND
The path to a custom background index file.
--custom_index CUSTOM_INDEX
The path to a custom background file.
--downsample DOWNSAMPLE
The number of sequences to downsample from the input file. Default is None.
Example:
snetcr --filename ./snetcr/data/test.tsv --chain AB --species human --radius 96 --ratio 10 --suffix result --outdir ./testresult/
Note:
When analyzing multiple files, the -f or --filename should remain unspecified. Instead -d or --directory should be used.
Accepted formats
The method accepts data in the AIRR format or the paired TCRdist format. Data in the AIRR format should contain at least the following columns: v_call, j_call, junction, junction_aa. In case of using paired chain data, make sure the AIRR-formated data also includes the columns cell_id and locus. Data in the paired TCRdist format should contain at least the following columns: va, ja, cdr3a, cdr3a_nucseq, vb, jb, cdr3b, cdr3b_nucseq.
Advanced use (python interface)
Alternatively, the python interface can be used, which allows for more flexibility and provides additional functionalities.
Data formatting
The first important step is correctly formatting the TCR repertoire data. This implies that your data contains TCRs that satisfy the following specific criteria:
- Only canonical CDR3 sequences (N-terminal cysteine (C) and C-terminal phenylalanine (F), tryptophan (W) or cysteine (C)) that contain at least 4 and at most 30 amino acids. Non-amino acid characters are not allowed.
- V/J genes should be IMGT-formatted and must not include non-functional variants (ORFs/pseudogenes).
- The CDR3 nucleotide sequence should exactly match the CDR3 amino acid sequence.
To facilitate this formatting, you can make use of the Repertoire class.
It is important to distinguish datasets in the single column or paired column format. Note that paired chain data may also be in the single column format, when TCRα and TCRβ chains are linked by the cell_id column. Here are some examples of data in the single column format:
# EXAMPLE 1 (TRB only)
junction_aa junction v_call j_call
CASSPQFTGSYEQYF TGCGCCAGCAGCCCCCAGTTCACAGGCTCCTACGAGCAGTACTTC TRBV4-3*01 TRBJ2-7*01
CASSSPIAGQSSYEQYF TGTGCCAGCAGTTCCCCCATAGCGGGACAAAGCTCCTACGAGCAGT... TRBV28*01 TRBJ2-7*01
CASSYGQNYNEQFF TGCGCCAGCAGCTACGGACAGAACTACAATGAGCAGTTCTTC TRBV5-1*01 TRBJ2-1*01
...
# EXAMPLE 2 (paired chain, but single column)
v_call j_call junction_aa cell_id locus
TRAV20*01 TRAJ3*01 CAVQAGWEASKIIF AAGACCTAGTACACCT-1 TRA
TRAV19*01 TRAJ52*01 CALSEGAGGTSYGKLTF ACGCCGAGTCTCTTAT-1 TRA
TRBV13*01 TRBJ2-2*01 CASSLQGAKSTGELFF AAGACCTAGTACACCT-1 TRB
...
In contrast, paired column data contains separate columns for TCRα and TCRβ. Here is an example of what the paired column format looks like:
# EXAMPLE
cdr3a cdr3a_nucseq va ja cdr3b cdr3b_nucseq vb jb
CVVKILTGGGNKLTF TGTGTGGTGAAGATACTCACGGGAGGAGGAAACAAACTCACCTTT TRAV12-1*01 TRAJ10*01 CASSPLADSSGSSYEQYF TGTGCCAGCTCACCTCTCGCCGACAGCTCAGGGAGCTCCTACGAGCAGTACTTC TRBV18*01 TRBJ2-7*01
CILADTGTASKLTF TGCATCCTGGCCGATACCGGCACTGCCAGTAAACTCACCTTT TRAV26-2*01 TRAJ44*01 CASKERGGLYEQYF TGTGCCAGCAAGGAGCGGGGGGGCCTTTACGAGCAGTACTTC TRBV11-2*01 TRBJ2-7*01
CALDMDGNTPLVF TGTGCTCTAGACATGGACGGAAACACACCTCTTGTCTTT TRAV6*01 TRAJ29*01 CASSPRQGAGANVLTF TGTGCCAGCAGCCCCAGACAGGGAGCCGGGGCCAACGTCCTGACTTTC TRBV5-4*01 TRBJ2-6*01
...
The code block below shows an example of how each of these would be formatted.
from snetcr.repertoire import Repertoire
from snetcr import load_test
# EXAMPLE 1: single column format
data = load_test(column_type='single')
formatter = Repertoire(data)
data_formatted = formatter.filter_and_format_single(
cdr3aa_col = 'junction_aa', # default
cdr3nt_col = 'junction', # default
vgene_col = 'v_call', # default
jgene_col = 'j_call' # default
)
# EXAMPLE 2: paired column format
data = load_test(column_type='paired')
formatter = Repertoire(data)
data_formatted = formatter.filter_and_format_paired(
cdr3aa_a_col = 'cdr3a', # default
cdr3nt_a_col = 'cdr3a_nucseq', # default
vgene_a_col = 'va', # default
jgene_a_col = 'ja', # default
cdr3aa_b_col = 'cdr3b', # default
cdr3nt_b_col = 'cdr3b_nucseq', # default
vgene_b_col = 'vb', # default
jgene_b_col = 'jb' # default
)
Calculating neighbor distributions
The find_neighbors function provides a simple method for calculating the sequence neighbor distribution in your sample at a fixed TCRdist threshold r.
from snetcr.datasets import load_test
tcrs = snetcr.load_test() # test data -> change to your own data here
nbrs = find_neighbors(
tcrs = tcrs,
chain = 'AB',
radius = 96,
)
Sequence neighbor enrichment
To add some interpretation to the neighbor counts, you can perform a neighbor enrichment analysis. This will compare the neighbor distribution in the sample with a synthetic background sample to estimate the expected neighbor counts. The code block below shows the most basic example where we run the analysis for a single paired αβ chain repertoire using a TCRdist radius of < 96.
from snetcr.neighbors import neighbor_analysis
result = neighbor_analysis(
tcrs = tcrs,
chain = 'AB', # paired chain (alpha-beta)
organism = 'human',
radius = 96 # TCRdist distance radius
)
After running the analysis, you can access the data in the SneTcrResult object. If you want to perform clustering on the enrichment results, you should run .get_clusters() before extracting the results.
res.get_clusters() # this will add a 'cluster' column to the results table
clustered_results = res.to_df() # extracts the results table as a pandas.DataFrame
Calculating the pairwise distance matrix using vectorized TCRdist
If you want to calculate the pairwise distances among a set of TCRs, you can simply run the example provided in this code block. This will produce a sparse distance matrix where zero-distances are encoded as -1. Here, r will determine the maximum distance that is included. Increasing r will slow down the computing time. Note that when r is very large, this may result in memory issues.
from snetcr.distance import compute_sparse_distance_matrix
dm = compute_sparse_distance_matrix(
tcrs = tcrs,
chain = 'AB',
organism = 'human',
r = 96
)
Generating background data
The following functionality allows you to generate a set of background TCRs that match a range of characteristics in the provided data. These include matching V and J gene frequency, CDR3 amino acid length distribution, and the number of n-inserted nucleotides in the CDR3. The size of the background can be specified as a factor of the input data. By default, the model will generate a background dataset that is 10x the size of the input data.
from snetcr.background import BackgroundModel
bgmodel = BackgroundModel(
repertoire = tcrs,
factor = 5 # relative to the size of the input data
)
background = bgmodel.shuffle(chain='AB') # specify the chain here
vecTCRdist (TCRdist-based TCR encoding)
The TCRdist-based encoding vecTCRdist is a transformation of the TCRdist distance matrix, that enables accurate approximations of TCRdist distances in euclidean space. vecTCRdist captures information from CDR1, CDR2, CDR2.5, and CDR3.
from snetcr.encoding import TCRDistEncoder
encoder = TCRDistEncoder(
aa_dim = 8, # number of dimensions per amino acid
organism = 'human'
chain = 'AB'
)
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file snetcr-0.1.2b2.tar.gz.
File metadata
- Download URL: snetcr-0.1.2b2.tar.gz
- Upload date:
- Size: 10.5 MB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.1.1 CPython/3.9.19
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
d98571e9a67bd1311b7bff546e138b32f59b742d910e10b0f14793c4517924f8
|
|
| MD5 |
f39612c615e2b9ce2257f1835f451e6a
|
|
| BLAKE2b-256 |
6e4eae45d36d88b75bdf91432f30e1c6ab7034bf66ff00b4ef0597f4e35107d0
|
File details
Details for the file snetcr-0.1.2b2-py2.py3-none-any.whl.
File metadata
- Download URL: snetcr-0.1.2b2-py2.py3-none-any.whl
- Upload date:
- Size: 11.0 MB
- Tags: Python 2, Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/5.1.1 CPython/3.9.19
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
d86d514b8ff3c193cd7dd51a14c5a8bd236fe843e3f5e8cbc9ded87a763ca1e9
|
|
| MD5 |
c497142cc448bb0014efc2154a466ef1
|
|
| BLAKE2b-256 |
5a96d8f1bad9098f89862ab39d509de4c2e7fb7d4a68960b902580269c4bf14c
|