Skip to main content

Pairwise distance calculation and neighborhood enrichment analysis of TCR repertoires

Project description

Detection of antigen-driven convergent T-cell responses

PyPI

The snetcr library allows for statistical quantification of TCR sequence similarity through enrichment analysis of sequence neighbor counts. snetcr builds on the concept of TCR neighborhoods introduced in Mayer-Blackwell et al. (2021), eLife. The library makes use of efficient vectorization in order to compute neighbor distributions. In addition it uses a novel strategy for generating TCR repertoire backgrounds that match important properties of the input repertoire such as V/J gene frequency, CDR3 length and non-templated nucleotide insertion in the CDR3.

Installation

snetcr is available as a pypi package. To install the package, simply run:

pip install snetcr

⚠️ Note: Make sure you have Fortran compiler like gfortran, which is necessary for running certain dependencies of the software.

Use

Command line interface

By far the easiest way to run the analysis is through the using of the command line interface.

usage: snetcr [-h] [-f FILENAME] [-d DIRECTORY] [-r RADIUS] [-q RATIO] [-c CHAIN] [-s SPECIES] [-x SUFFIX] -o OUTDIR [--custom_background CUSTOM_BACKGROUND] [--custom_index CUSTOM_INDEX] [--downsample DOWNSAMPLE]

optional arguments:
  -h, --help            show this help message and exit
  -f FILENAME, --filename FILENAME
                        Path to the file that contains the repertoire of interest. When analyzing multiple files at once, please use the 'directory' argument.
  -d DIRECTORY, --directory DIRECTORY
                        Path to the directory that contains the repertoires of interest. When analyzing a single file, please use the 'filename' argument.
  -r RADIUS, --radius RADIUS
                        The radius for defining neighbors. Default is 12.5.
  -q RATIO, --ratio RATIO
                        The ratio between background and foreground. Only applicable when no custom background is provided. Default is 10.
  -c CHAIN, --chain CHAIN
                        TCR chain. AB for alphabeta. Default is B.
  -s SPECIES, --species SPECIES
                        Species. Default is human.
  -x SUFFIX, --suffix SUFFIX
                        A suffix to add to the output file name.
  -o OUTDIR, --outdir OUTDIR
                        Path to directory where results will be saved. If directory is non-existent, a new one will be created.
  --custom_background CUSTOM_BACKGROUND
                        The path to a custom background index file.
  --custom_index CUSTOM_INDEX
                        The path to a custom background file.
  --downsample DOWNSAMPLE
                        The number of sequences to downsample from the input file. Default is None.

Example:

snetcr --filename ./snetcr/data/test.tsv --chain AB --species human --radius 96 --ratio 10 --suffix result --outdir ./testresult/

Note:

When analyzing multiple files, the -f or --filename should remain unspecified. Instead -d or --directory should be used.

Accepted formats

The method accepts data in the AIRR format or the paired TCRdist format. Data in the AIRR format should contain at least the following columns: v_call, j_call, junction, junction_aa. In case of using paired chain data, make sure the AIRR-formated data also includes the columns cell_id and locus. Data in the paired TCRdist format should contain at least the following columns: va, ja, cdr3a, cdr3a_nucseq, vb, jb, cdr3b, cdr3b_nucseq.

Advanced use (python interface)

Alternatively, the python interface can be used, which allows for more flexibility and provides additional functionalities.

Data formatting

The first important step is correctly formatting the TCR repertoire data. This implies that your data contains TCRs that satisfy the following specific criteria:

  • Only canonical CDR3 sequences (N-terminal cysteine (C) and C-terminal phenylalanine (F), tryptophan (W) or cysteine (C)) that contain at least 4 and at most 30 amino acids. Non-amino acid characters are not allowed.
  • V/J genes should be IMGT-formatted and must not include non-functional variants (ORFs/pseudogenes).
  • The CDR3 nucleotide sequence should exactly match the CDR3 amino acid sequence.

To facilitate this formatting, you can make use of the Repertoire class.

It is important to distinguish datasets in the single column or paired column format. Note that paired chain data may also be in the single column format, when TCRα and TCRβ chains are linked by the cell_id column. Here are some examples of data in the single column format:

# EXAMPLE 1 (TRB only)
junction_aa	junction	v_call	j_call
CASSPQFTGSYEQYF	TGCGCCAGCAGCCCCCAGTTCACAGGCTCCTACGAGCAGTACTTC	TRBV4-3*01	TRBJ2-7*01
CASSSPIAGQSSYEQYF	TGTGCCAGCAGTTCCCCCATAGCGGGACAAAGCTCCTACGAGCAGT...	TRBV28*01	TRBJ2-7*01
CASSYGQNYNEQFF	TGCGCCAGCAGCTACGGACAGAACTACAATGAGCAGTTCTTC	TRBV5-1*01	TRBJ2-1*01
...

# EXAMPLE 2 (paired chain, but single column)
v_call	j_call	junction_aa	cell_id	locus
TRAV20*01	TRAJ3*01	CAVQAGWEASKIIF	AAGACCTAGTACACCT-1	TRA
TRAV19*01	TRAJ52*01	CALSEGAGGTSYGKLTF	ACGCCGAGTCTCTTAT-1	TRA
TRBV13*01	TRBJ2-2*01	CASSLQGAKSTGELFF	AAGACCTAGTACACCT-1	TRB
...

In contrast, paired column data contains separate columns for TCRα and TCRβ. Here is an example of what the paired column format looks like:

# EXAMPLE
cdr3a	cdr3a_nucseq	va	ja	cdr3b	cdr3b_nucseq	vb	jb
CVVKILTGGGNKLTF	TGTGTGGTGAAGATACTCACGGGAGGAGGAAACAAACTCACCTTT	TRAV12-1*01	TRAJ10*01	CASSPLADSSGSSYEQYF	TGTGCCAGCTCACCTCTCGCCGACAGCTCAGGGAGCTCCTACGAGCAGTACTTC	TRBV18*01	TRBJ2-7*01
CILADTGTASKLTF	TGCATCCTGGCCGATACCGGCACTGCCAGTAAACTCACCTTT	TRAV26-2*01	TRAJ44*01	CASKERGGLYEQYF	TGTGCCAGCAAGGAGCGGGGGGGCCTTTACGAGCAGTACTTC	TRBV11-2*01	TRBJ2-7*01
CALDMDGNTPLVF	TGTGCTCTAGACATGGACGGAAACACACCTCTTGTCTTT	TRAV6*01	TRAJ29*01	CASSPRQGAGANVLTF	TGTGCCAGCAGCCCCAGACAGGGAGCCGGGGCCAACGTCCTGACTTTC	TRBV5-4*01	TRBJ2-6*01
...

The code block below shows an example of how each of these would be formatted.

from snetcr.repertoire import Repertoire
from snetcr import load_test

# EXAMPLE 1: single column format
data = load_test(column_type='single')
formatter = Repertoire(data)
data_formatted = formatter.filter_and_format_single(
    cdr3aa_col = 'junction_aa', # default
    cdr3nt_col = 'junction', # default
    vgene_col = 'v_call', # default
    jgene_col = 'j_call' # default
)

# EXAMPLE 2: paired column format
data = load_test(column_type='paired')
formatter = Repertoire(data)
data_formatted = formatter.filter_and_format_paired(
    cdr3aa_a_col = 'cdr3a', # default
    cdr3nt_a_col = 'cdr3a_nucseq', # default
    vgene_a_col = 'va', # default
    jgene_a_col = 'ja', # default 
    cdr3aa_b_col = 'cdr3b', # default
    cdr3nt_b_col = 'cdr3b_nucseq', # default
    vgene_b_col = 'vb', # default
    jgene_b_col = 'jb' # default
)	

Calculating neighbor distributions

The find_neighbors function provides a simple method for calculating the sequence neighbor distribution in your sample at a fixed TCRdist threshold r.

from snetcr.datasets import load_test

tcrs = snetcr.load_test() # test data -> change to your own data here
nbrs = find_neighbors(
    tcrs = tcrs,
    chain = 'AB',
    radius = 96,
)

Sequence neighbor enrichment

To add some interpretation to the neighbor counts, you can perform a neighbor enrichment analysis. This will compare the neighbor distribution in the sample with a synthetic background sample to estimate the expected neighbor counts. The code block below shows the most basic example where we run the analysis for a single paired αβ chain repertoire using a TCRdist radius of < 96.

from snetcr.neighbors import neighbor_analysis

result = neighbor_analysis(
    tcrs = tcrs,
    chain = 'AB', # paired chain (alpha-beta)
    organism = 'human',
    radius = 96 # TCRdist distance radius
)
Clustering

After running the analysis, you can access the data in the SneTcrResult object. If you want to perform clustering on the enrichment results, you should run .get_clusters() before extracting the results.

res.get_clusters(
    periphery = True # if set to True, this will include the 'periphery' (all neighbors) around each SNE
) # this will add a 'cluster' column to the results table
clustered_results = res.to_df() # extracts the results table as a pandas.DataFrame
Visualization

After clustering, the results can be visualized as a network:

import matplotlib.pyplot as plt

fig, ax = plt.subplots(dpi=150, figsize=(4,4))
res.draw_neighborhoods(
    ax = ax, 
    node_size = 'duplicate_count', # Will use the duplicate_count column to set the node size
    annotate = True # Adds the cluster labels
)

neighborhoods_network.png

In addition, each cluster can be individually inspected to gain more insight into the V/J gene usage and the CDR3 amino acid motif.

Calculating the pairwise distance matrix using vectorized TCRdist

If you want to calculate the pairwise distances among a set of TCRs, you can simply run the example provided in this code block. This will produce a sparse distance matrix where zero-distances are encoded as -1. Here, r will determine the maximum distance that is included. Increasing r will slow down the computing time. Note that when r is very large, this may result in memory issues.

from snetcr.distance import compute_sparse_distance_matrix

dm = compute_sparse_distance_matrix(
    tcrs = tcrs,
    chain = 'AB',
    organism = 'human',
    r = 96
)

Generating background data

The following functionality allows you to generate a set of background TCRs that match a range of characteristics in the provided data. These include matching V and J gene frequency, CDR3 amino acid length distribution, and the number of n-inserted nucleotides in the CDR3. The size of the background can be specified as a factor of the input data. By default, the model will generate a background dataset that is 10x the size of the input data.

from snetcr.background import BackgroundModel

bgmodel = BackgroundModel(
	repertoire = tcrs,
	factor = 5 # relative to the size of the input data
)

background = bgmodel.shuffle(chain='AB') # specify the chain here

vecTCRdist (TCRdist-based TCR encoding)

The TCRdist-based encoding vecTCRdist is a transformation of the TCRdist distance matrix, that enables accurate approximations of TCRdist distances in euclidean space. vecTCRdist captures information from CDR1, CDR2, CDR2.5, and CDR3.

from snetcr.encoding import TCRDistEncoder

encoder = TCRDistEncoder(
    aa_dim = 8, # number of dimensions per amino acid
    organism = 'human'
    chain = 'AB'
)

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

snetcr-0.1.3.tar.gz (10.5 MB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

snetcr-0.1.3-py2.py3-none-any.whl (11.0 MB view details)

Uploaded Python 2Python 3

File details

Details for the file snetcr-0.1.3.tar.gz.

File metadata

  • Download URL: snetcr-0.1.3.tar.gz
  • Upload date:
  • Size: 10.5 MB
  • Tags: Source
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/5.1.1 CPython/3.9.19

File hashes

Hashes for snetcr-0.1.3.tar.gz
Algorithm Hash digest
SHA256 f013402b7fdd68b18c43971ad95d64d5c59e712f8e49a450ee29b08fac52afc6
MD5 3346581924876a8640eae5fa10fc627f
BLAKE2b-256 cea8eb353379c6235e16ea7098ba60e640b58e49413645e3baa0ab58043f69aa

See more details on using hashes here.

File details

Details for the file snetcr-0.1.3-py2.py3-none-any.whl.

File metadata

  • Download URL: snetcr-0.1.3-py2.py3-none-any.whl
  • Upload date:
  • Size: 11.0 MB
  • Tags: Python 2, Python 3
  • Uploaded using Trusted Publishing? No
  • Uploaded via: twine/5.1.1 CPython/3.9.19

File hashes

Hashes for snetcr-0.1.3-py2.py3-none-any.whl
Algorithm Hash digest
SHA256 71bcbb7323d4bf69ef4d5b4d7c90475404c9ff542396d80263852cfa60e58ccc
MD5 5862756760466fc13d20d78138738a76
BLAKE2b-256 a14484a0958fafccda1dc8489a25e90f56d08c73087ce84ef632dc96c0abed17

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page