vdjtools — immune-repertoire analysis
TCR/BCR immune-repertoire analysis — a clean-room Python + C++ rewrite of the legacy Groovy/Java vdjtools, standardised on the AIRR schema and polars DataFrames with minimal object-orientation.
Built on the antigenomics ecosystem: seqtree (fuzzy search / e-value engine), vdjmatch (overlap + TCRnet), arda (AIRR annotation + markup repair).
Status:
v3.0.0— the native V(D)J model engine plus the full analytics suite (diversity, overlap/TCRnet, preprocessing, biomarkers, single-cell), longitudinal clonotype dynamics (paired expansion testing + the VDJtrack recapture model), CDR features, and legacy-format ingestion (MiXcr, MiGec, immunoSEQ, IMGT/HighV-QUEST, Vidjil, RTCR, TRUST4, arda). Clonotype columns follow the AIRR junction convention (junction_nt/junction_aa). The legacy v1.x tool lives on thelegacy-1.xbranch and its releases remain available under the repository tags (v0.0.1…1.2.1).
Install
pip install vdjtools
Prebuilt wheels ship for CPython 3.10–3.13 on Linux, macOS (Apple Silicon), and Windows; the
native _core C++ extension is bundled (the source distribution compiles it on install).
That one command gives you everything vdjtools advertises — no extras to opt into. The three antigenomics engines it delegates to are base dependencies:
| Engine | Powers |
|---|---|
| arda | the germline reference (V/D/J + CDR3 anchors), model engine, annotation |
| seqtree | fuzzy search / e-values → error correction, similarity overlap, TCRnet |
| vdjmatch | sample overlap, TCRnet, metaclonotypes |
So preprocess.correct(), overlap.tcrnet(), biomarker.metaclonotypes() and
model.reference.load_germline() all just work from a plain install — and downstream libraries
can depend on plain vdjtools and rely on them being there. All three are imported lazily, so
import vdjtools stays light; between them they add only requests on top of what vdjtools
already needs. arda fetches its IMGT reference once, on first use.
Two things are still optional, because each has a working alternative or is a side integration:
pip install "vdjtools[overlap]" # scikit-learn — only for cluster_samples(method="mds");
# method="hclust" works out of the box (scipy)
pip install "vdjtools[sc]" # single-cell: anndata + awkward + mudata (scverse
# bridges), pyyaml (AIRR Cell export)
MMseqs2 is needed only for arda's alignment/annotation path (model.stitch.annotate) — never
for germline lookup, Pgen, generation, or the analytics. Install it via conda/brew if you need it.
Development
Uses uv — one repo-local .venv, no conda:
uv venv && source .venv/bin/activate
uv pip install -e ".[dev,test]" # builds the _core C++ extension (scikit-build-core)
Or run the bootstrap script (portable across bash/zsh, uv-first with a python -m venv fallback):
bash setup.sh --dev-parents --tests # or: zsh setup.sh
You need a C++ toolchain (Xcode CLT on macOS, build-essential on Linux) for the native _core
extension. MMseqs2 is arda's aligner, needed only for the annotation path and the slow arda
round-trip tests — brew install mmseqs2, or use the optional environment.yml conda env which
bundles it.
Quickstart — recombination model engine
Precomputed models for all 7 human loci ship in the wheel — no OLGA or download needed:
from vdjtools.model import load_bundled, native
from vdjtools.model.generate import generate
model = load_bundled("TRB", source="olga") # or source="learned" (fit to real repertoires)
native.pgen_nt(model, "TGTGCCAGCAGC...") # nucleotide generation probability (native C++)
native.pgen_aa(model, "CASSLAPGATNEKLFF") # amino-acid Pgen (codon-marginalised)
native.pgen_aa(model, "CASSLAPGATNEKLFF", mismatches=1) # + the whole Hamming-1 ball
native.pgen_aa_batch(model, seqs, mismatches=1, threads=0) # Pgen over many CDR3s, thread-parallel (~11×)
generate(model, 1000, seed=1) # sample a repertoire -> polars DataFrame
# seed= is process-stable from 3.3.0
Where Pgen sums over recombination scenarios, model.viterbi takes the argmax — the single
most likely one, which is the V/D/J boundary markup:
from vdjtools.model import best_scenario
sc = best_scenario(model, "TGTGCCAGCAGCTTAGGGACAGGGGGCTACGAGCAGTACTTC",
v="TRBV19*01", j="TRBJ2-7*01") # ALLELE names, as the model's tables are
sc.v_end, sc.d_call, sc.d_start, sc.d_end, sc.j_start # 0-based, half-open, in CDR3-nt space
# -> 8, 'TRBD1*01', 15, 24, 26
It reuses the same tables and the same loops as pgen_nt, so the chosen D obeys P(D|J) — a
TRBD2–TRBJ1 pair is genomically impossible and cannot be called.
infer_nt goes the other way, reconstructing a nucleotide CDR3 from an amino-acid one — the
VDJdb case, where a record carries (V, J, CDR3aa) and no nucleotides:
from vdjtools.model import infer_nt
sc = infer_nt(model, "CASSLGQAYEQYF", v="TRBV5-1*01", j="TRBJ2-3*01")
sc.cdr3_nt, sc.pgen, sc.margin # sequence, its exact Pgen, and how far ahead of the runner-up
Germline positions are pinned to their segment; each free N-region position takes the nucleotide the insertion model prefers. It reproduces the exponential brute-force oracle exactly on every record the oracle can resolve (25/25 TRG, 19/19 TRA) — fixing the germline trim first and then picking the best codon per residue only manages 9/25 and 4/19, because a trim chosen before the codons pins a codon the true optimum would have trimmed away.
The search is native (the same Pi_L·Pi_R transfer matrix as pgen_aa, with max for the sums):
2.5 ms per human TRB CDR3, 0.5 ms per TRA — all 80k VDJdb records in about 3 minutes. v=/j=
take one allele, several (a list or the comma-separated string an ambiguous v_call carries), or
nothing at all, in which case the DP marginalizes over every gene at essentially no extra cost.
Matches OLGA's Pgen to machine precision across all 7 loci, and adds tandem-D (D-D) support that
OLGA/IGoR lack. Learn a model from your own non-functional reads (out-of-frame or stop-codon — both escaped
selection, which is all a generative model needs) with model.infer.infer_native.
Explore any model's recombination Bayes net interactively (entropy, mutual information, marginals):
pip install "vdjtools[examples]"
marimo edit examples/model_explorer.py
Interactive marimo notebooks (data auto-loads from HuggingFace, or a local ~/hf/ copy):
examples/vaccination_tracking.py— clonotype tracking + the recapture model across yellow-fever / influenza / TBE vaccination time courses (vdjtools.dynamics).examples/aging.py— cohort-streaming diversity, clone-size and spectratype vs age.examples/ankspond_motif.py— the ankylosing-spondylitis TRBV9 "AS27" motif: disease vs HLA-B27 carriage.examples/biomarker_explorer.py— Emerson public-TCR association + co-occurrence.
Command line
pip install vdjtools installs the vdjtools command — the model engine (OLGA/IGoR-style) and the
repertoire analytics (over sample files or a metadata table, like the legacy tool):
# recombination model engine — built-in models for all 7 loci (no download)
vdjtools models # list the bundled models
vdjtools generate -m TRB -n 1000 -o gen.tsv # sample sequences (cf. olga-generate_sequences)
vdjtools pgen seqs.tsv -m TRB -o pgen.tsv # Pgen per CDR3 (cf. olga-compute_pgen)
vdjtools pgen seqs.tsv -m TRB --mismatches 1 # + the Hamming-1 ball; --v-col/--j-col to condition
# model workshop — a model is a directory, or LOCUS[:source[:organism]]
vdjtools model check TRB:learned # audit vs its germline; exits 1 on an error
vdjtools model template --locus TRB -o tmpl/ # scaffold from arda, or your own --germline-v/-j
vdjtools model learn clones.tsv -t tmpl/ -o fitted/ # EM on your sequences (--init template = fine-tune)
vdjtools model log fitted/ # log-likelihood per iteration
vdjtools model diversity TRB:olga # entropy + total diversity estimate
vdjtools model compare TRB:olga TRB:learned --by gene --dot diff.pdf
vdjtools model loglik seqs.tsv TRB:learned # log-likelihood, free parameters, AIC, BIC
vdjtools model extend fitted/ --locus TRB -o bigger/ # add a larger allele library
vdjtools model export TRB:olga --long -o marginals.tsv
# data — convert any format to the canonical table (TSV, or Parquet by extension), preprocess
vdjtools convert mixcr.txt.gz -o clones.parquet # MiXcr/immunoSEQ/AIRR/… → canonical Parquet
vdjtools downsample clones.parquet 100000 -o ds.tsv
# filtering — THREE SEPARATE AXES, deliberately separate flags:
# --productive the REARRANGEMENT encodes a chain (AIRR: in frame, no stop codon)
# --functional-genes the GERMLINE GENE is real (IMGT: F / ORF / P)
# --min-len/--max-len junction_aa length, INCLUSIVE (default sanity bound 5..60)
# A productive rearrangement can still use a pseudogene V — filtering one says nothing
# about the other.
vdjtools filter clones.parquet --productive --min-freq 1e-4 -o productive.tsv
vdjtools filter clones.parquet --nonproductive -o nonproductive.tsv # isolate them instead
vdjtools filter clones.parquet --functional-genes --keep-orf -o f_orf.tsv
vdjtools filter clones.parquet --productive --keep-frequencies -o kept.tsv # file's own freqs
# cross-batch V/J-usage bias — correct the usage, and rewrite the clonotype tables
vdjtools correct-vj s1.tsv s2.tsv s3.tsv s4.tsv -b A,A,B,B \
--transform sigmoid --usage-out usage.tsv --outdir corrected/
vdjtools pool s1.tsv s2.tsv s3.tsv --join --min-samples 2 -o joint.tsv
# repertoire analytics — sample files, or a cohort via -m/--metadata + --base-dir
vdjtools diversity sampleA.tsv sampleB.tsv -o diversity.tsv
vdjtools overlap *.tsv -o overlap.tsv
vdjtools segment-usage *.tsv --segment v -o usage.tsv
vdjtools spectratype *.tsv -o spectra.tsv
vdjtools diversity -m metadata.txt --base-dir samples/ --threads 8 -o div.tsv # parallel cohort
vdjtools spectratype --cohort cohort_parquet/ -o spectra.tsv # one streamed pass
# the portable signature — one fixed, named, positional feature vector per sample
vdjtools signature --preset classify -m metadata.txt --base-dir samples/ -o sig.tsv
vdjtools signature --preset compact *.tsv -t 0 -o vsig.parquet # -t 0 = every core
vdjtools presets # the named feature sets, ranked
vdjtools presets classify # what one preset is, and when to use it
vdjtools signature --describe --preset classify # the column dictionary; reads no input
# longitudinal — paired within-donor expansion test between two timepoints
vdjtools dynamics day0.tsv day15.tsv -o tracked.tsv
Native vdjtools, AIRR Rearrangement, Parquet, and third-party inputs are auto-detected; every
command writes to -o — TSV, or Parquet when the path ends in .parquet / .pq — or to stdout
(so it pipes). Cohort commands parallelise over samples with -t/--threads or stream a pre-ingested
Parquet cohort with --cohort. Run vdjtools <command> --help for options.
Analytics (Python API)
Every reader returns one canonical polars clonotype frame (AIRR junction columns), and every
analysis function takes and returns such frames — so results chain together and drop straight into
plotting. A tour of the analysis modules (full runnable walkthrough in the
User guide):
from vdjtools import io as vio, stats, features, overlap, preprocess
# load (auto-detects MiXcr / immunoSEQ / AIRR / native / … and converts), or a whole cohort:
sample = vio.read("clones.tsv")
cohort = vio.read_samples(vio.read_metadata("metadata.txt"), base_dir="samples/")
# diversity, rarefaction, segment usage, spectratype
stats.diversity_stats(sample) # observed, Chao1, Shannon, inverse-Simpson, d50, …
stats.inext(sample, q=(0, 1, 2)) # Hill-number rarefaction/extrapolation + bootstrap CIs
stats.segment_usage(sample, "v") # V (or "j") usage; stats.spectratype(sample)
# CDR3 physicochemistry & k-mers
features.physchem_profile(sample, region="all")
# repertoire overlap & TCRnet (fuzzy/similarity/TCRnet via the [overlap] engine)
overlap.overlap_metrics(sampleA, sampleB) # F / D / Jaccard / Morisita-Horn …
overlap.tcrnet(sample) # per-clonotype neighbourhood enrichment
# preprocessing: downsample to a common depth, error-correct, filter, pool
preprocess.downsample(sample, 100_000)
preprocess.correct(preprocess.filter_productive(sample))
# three filtering axes, kept apart: AIRR productivity, IMGT gene functionality, length
preprocess.filter_productive(sample, recompute_frequencies=False) # keep the file's freqs
preprocess.filter_functional_genes(sample, keep=("F", "ORF")) # IMGT axis
preprocess.filter_length(sample, min_len=5, max_len=60) # inclusive bounds
# cross-batch V/J-usage bias: batch-correct usage, then resample the clonotype table
usage = preprocess.correct_vj_usage(cohort, batch_col="batch", transform="sigmoid")
fixed = preprocess.apply_vj_correction(sampleA, usage, sample_id="A0")
The portable signature — one repertoire in, a fixed named positional feature vector out, on a
scale a downstream model can consume without fitting a scaler of its own. This is the statistics
half (vsig); the geometry half (rsig, features of the prototype-sum embedding) is
mirpy's mir.signature, and the two concatenate on
sample_id into one contract:
from vdjtools.signature import vsig, vsig_cohort, columns, describe
v = vsig({"TRB": sample}, tier="standard") # {column: value}, in frozen layout order
describe("standard") # the column dictionary
Every feature carries a variance-stabilising transform chosen from its support — Haldane–Anscombe
logit for a proportion, Anscombe arcsine for a share, CLR (k−1 parts) for a composition, log for
a count — so that a read count, an isotype fraction and a principal component can sit in one
matrix. core ⊂ standard ⊂ full are exact index subsets of one frozen column order. A locus
that was not sequenced is nan plus a mask: column, never a zero.
Longitudinal tracking — which clonotypes changed between two timepoints, and the VDJtrack recapture model (Pavlova, Zvyagin & Shugay 2024):
from vdjtools import dynamics
# paired within-donor test: emergent / expanded / persistent / contracted / vanishing
tracked = dynamics.test_pair(day0, day15) # depth handled per-pair (effective N)
grouped = dynamics.test_metaclonotypes(day0, day15, scope="1,0,0,1") # 1-Hamming CDR3 ball first
called = dynamics.expansion_test(day0, day15) # edgeR NB-exact caller (log2FC + p)
# VDJtrack size-bucket recapture model — recapture fraction per clone-size class (Beta bands);
# split by a group column + capture_test() for the group effect (see examples/vaccination_tracking.py)
rates = dynamics.capture_rates(pre, post)
Incidence-based clonotype association (Emerson 2017 / Howie 2015 / De Witt 2018 / Vlasova 2026) — a choice of test, condition, and co-occurrence — and single-cell paired-chain Pgen:
from vdjtools import biomarker, sc
from vdjtools.biomarker import association, condition
# feature vs condition: Fisher / chi2 / Bayesian / permutation; binary, per-HLA-allele, or CMH-stratified
association(cohort, condition.binary(meta, "cmv"), test=["fisher", "bayes_bf"])
association(cohort, condition.stratified(meta, "cmv", "hla"), stratum_col="_stratum") # CMV | HLA (CMH)
# feature vs feature: in-silico α-β pairing / same-chain co-specificity (θ lift + Fisher + FDR)
biomarker.cooccurrence(cohort, chain_a="TRA", chain_b="TRB", evalue=True)
sc.paired_pgen(sc.pair_chains(sc.read_10x("filtered_contig_annotations.csv"))) # pgen_alpha·pgen_beta
Performance
The Pgen / generation / EM / diversity hot paths are a native C++ (pybind11) core; everything else is polars. Amino-acid Pgen matches OLGA to machine precision (1e-15) across all 7 loci while being several times faster, and the built-in models keep the resident set small. Single thread, Apple M3 (arm64), bundled human TRB model:
| operation | throughput | vs OLGA |
|---|---|---|
| nucleotide Pgen (single-D VDJ) | ~0.5 ms/seq | 9× |
| amino-acid Pgen | ~0.6–0.9 ms/seq | 8.6× |
| Pgen + Hamming-1 ball (1 substitution) | ~15 ms/seq | 8.7× |
| sequence generation | ~32 000 seq/s | — |
Nucleotide Pgen (via the same transfer-matrix DP as the aa path — an in-frame CDR3 is an aa query with
one codon fixed per position) is exact vs OLGA across all loci. Batched Pgen / 1-mismatch over many
CDR3s parallelises over sequences (native.pgen_aa_batch, ~11× on 16 cores, bitwise-identical to
the serial result); the EM E-step parallelises over reads (~6.7× on 8 threads); diversity/rarefaction
run on a native iNEXT kernel (bootstrap + parallel batch). Memory
stays light — ~63 MB resident for import vdjtools plus one loaded model, ~123 MB with all
seven bundled models resident. Reproduce with ~/vcs/projects/2026-vdjtools-benchmark/bench/bench_pgen.py and the test_*_benchmark.py
suites (RUN_BENCHMARK=1).
Capabilities (see the User guide and the API reference)
-
IO — canonical clonotype frame on AIRR junction columns (
junction_nt/junction_aa); readers for native vdjtools, AIRR Rearrangement TSV, and Parquet, plus format-detecting converters for MiXcr (v1/2 + v3/4, incl. C-gene / BCR isotype), MiGec, Adaptive immunoSEQ (v1/v2), IMGT/HighV-QUEST, Vidjil, RTCR, TRUST4, and arda AIRR output (vdjtools.io.convert); metadata-driven batch + hive-partitioned cohorts. -
Model — native V(D)J recombination model: generation probability (Pgen — nt, aa, 1-mismatch, V/J-agnostic, thread-parallel batch), sequence generation, and EM inference, all in a native (pybind11) core. Supersedes OLGA and IGoR: arda-driven scenario enumeration, polars marginal tables, read-parallelised EM, and tandem-D (D-D) support. Concordant with OLGA across all 7 loci; precomputed OLGA + real-data-learned models bundled (
load_bundled). -
Model workshop (user guide) — build a model on your own V(D)J germline library (
from_germline, FASTA + anchors) and fit it to your own sequences; export and re-import every marginal as tables; check a model against its germline (check_model— functional genes stuck at P=0, unreachable deletion mass, incomplete conditionals); read the EM training log and per-iteration likelihood; compare two models (per-event Jensen-Shannon / total variation, gene usage, a bnlearn-style comparison graph) and their Pgen distributions; compute log-likelihood, AIC and BIC of a clonotype set under a model; fine-tune it, extend it with a larger allele library, and re-weight V/J usage for protocol bias. Plus information content per recombination event and a total diversity estimate (human TRB: ~52 bits per rearrangement, ~45 bits per sequence, ~3·10¹³ effective sequences). -
Stats — diversity (Chao1/Shannon/Simpson/…), spectratype, V/J/VJ usage.
-
Features — CDR physicochemical profiles, k-mer / V+k-mer summaries.
-
Overlap — sample overlap and TCRnet (via vdjmatch/seqtree), similarity-aware overlap, clustering.
-
Preprocess — downsampling, error-correction, VJ-usage batch-effect correction, pooling/joining.
-
Biomarker — incidence association (Fisher / χ² / Bayesian / permutation) vs binary / HLA-allele / CMH-stratified conditions; α-β & same-chain co-occurrence pairing; metaclonotypes.
-
Dynamics — longitudinal clonotype tracking between timepoints: the paired within-donor expansion test (emergent / expanded / persistent / contracted / vanishing), the VDJtrack size-bucket recapture model, metaclonotype-grouped testing, and an edgeR NB-exact caller (
vdjtools.dynamics). -
Single-cell — CellRanger / AIRR Cell / arda ingestion, chain pairing + doublet & mispairing QC, paired α/β Pgen, clustering evaluation, and round-trip interop with the downstream single-cell stack (
vdjtools.sc, guide).Ecosystem Out Back in Needs scirpy / scverse to_scirpy(scirpy'sobsm["airr"], or aMuDatawith GEX)from_scirpyscirpyout; onlyawkwardbackdandelion to_dandelionfrom_dandelion,read_h5ddlsc-dandelionout; onlyh5pybackscRepertoire (R) write_screpertoire(AIRR or 10x shaped)— nothing Any AIRR consumer to_airr/write_airrfrom_airr,read_airr_cellnothing All four read the same thing — a flat AIRR Rearrangement table with
sequence_id+cell_id— so there is one emitter and one inverse, and each bridge is a thin adapter. Writing a container delegates to the library that owns it (no stale copy of someone else's schema to drift); reading one is ours, so a result handed to you is always openable.push_obspushes a vdjtools-computed column (pgen_paired, mispairing flags) onto anAnnData.obsorDandelion.metadatayou did not build. CLI:vdjtools sc convert|pair|qc|pgen|export.
License
GPL-3.0-or-later.
Release files for vdjtools 3.12.1
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| vdjtools-3.12.1.tar.gz | 2.6 MB | Details |
Built distributions (wheels)
Total release size: 23.7 MB
Release files / vdjtools-3.12.1.tar.gz
| Download URL | vdjtools-3.12.1.tar.gz |
|---|---|
| Size | 2.6 MB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
4cb08e8ec309dde960bd78bead44422ae2caa66de523a968bf2792bcaa2fdb8b
|
|
BLAKE2b-256 checksum How to use checksums |
b3c5215e2bd941bf27512c44fa31996acff59310cfea5a844a5268d849090c1d
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp313-cp313-win_amd64.whl
| Download URL | vdjtools-3.12.1-cp313-cp313-win_amd64.whl |
|---|---|
| Size | 1.7 MB |
| Tags | CPython 3.13 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
cb2df4896dbd8bf140dba416ee2207b7eb28d79d2355580cfafcb487c7f7b656
|
|
BLAKE2b-256 checksum How to use checksums |
823d1bd69fa34199f4d756bc42fcecc1142965e6437e0abdd485519ee3953d55
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp313-cp313-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | vdjtools-3.12.1-cp313-cp313-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.8 MB |
| Tags | CPython 3.13 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
c48e9682bde92874f9385c9a2692bf39af1e914c5140c88f5601639657360940
|
|
BLAKE2b-256 checksum How to use checksums |
27b351f99d9d6bc2086c7f8283ae1b97942f2911968dd7b87edbc0dda13728a8
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp313-cp313-macosx_11_0_arm64.whl
| Download URL | vdjtools-3.12.1-cp313-cp313-macosx_11_0_arm64.whl |
|---|---|
| Size | 1.7 MB |
| Tags | CPython 3.13 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
1fabb4d017132cff22aeebac05817ff9a1becd47aa2a7d515a04fe176cb34ed5
|
|
BLAKE2b-256 checksum How to use checksums |
d68b420cbb1e44c5eb781ddb21f280b3ffa1487150ca3032fad0e7d8eb5cf4b9
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp312-cp312-win_amd64.whl
| Download URL | vdjtools-3.12.1-cp312-cp312-win_amd64.whl |
|---|---|
| Size | 1.7 MB |
| Tags | CPython 3.12 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
2280ab92db017bef5326b8435b3824acfc3795c8f41c2d1f1705db1c9f0be7d5
|
|
BLAKE2b-256 checksum How to use checksums |
364ec5959f9cbaec49a6f3f4fafe4da29d0a7d57cdc206700c737d37494cb64f
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp312-cp312-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | vdjtools-3.12.1-cp312-cp312-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.8 MB |
| Tags | CPython 3.12 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
28db1650befa9ba148f295b12fde179ef297ebcc682efc323e942e7843f07cb2
|
|
BLAKE2b-256 checksum How to use checksums |
0a698659cc2fc936bc7c99414962f19b0b4d1be5730e50da88252e2adff71d93
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp312-cp312-macosx_11_0_arm64.whl
| Download URL | vdjtools-3.12.1-cp312-cp312-macosx_11_0_arm64.whl |
|---|---|
| Size | 1.7 MB |
| Tags | CPython 3.12 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
76d5be94d5b8e06e416edaa8433d2a519b5b5560524840d3c2b47b5561f84981
|
|
BLAKE2b-256 checksum How to use checksums |
4dcd4f116ee40d5e80db0459d870390c0ef3ca0580343912353166a87ac0c320
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp311-cp311-win_amd64.whl
| Download URL | vdjtools-3.12.1-cp311-cp311-win_amd64.whl |
|---|---|
| Size | 1.7 MB |
| Tags | CPython 3.11 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
ea2a6b59221a8f8dc73237fc6675a020018a3d9777b4883a3a2bf1302e9ef65f
|
|
BLAKE2b-256 checksum How to use checksums |
fb202c5067dbcf2680ee71df6bde35d4023cdf0ea4f0373877785da417441f0e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp311-cp311-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | vdjtools-3.12.1-cp311-cp311-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.8 MB |
| Tags | CPython 3.11 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
9606541facdf503babbf9a3b82ef059e0c84b2c171f25e8e543e860273cdacc4
|
|
BLAKE2b-256 checksum How to use checksums |
2a0d13f004f5e073be4518ba9a91dbb57325e397012c34c541262914943f3f32
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp311-cp311-macosx_11_0_arm64.whl
| Download URL | vdjtools-3.12.1-cp311-cp311-macosx_11_0_arm64.whl |
|---|---|
| Size | 1.7 MB |
| Tags | CPython 3.11 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
5deb17947d95f0feceeb5924cd82c27c87205375c31782085be9144f9973b53a
|
|
BLAKE2b-256 checksum How to use checksums |
dd725bff58073b742bb4753230bf42f2093c1aa9d7fe7e789eb481e5ff374669
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp310-cp310-win_amd64.whl
| Download URL | vdjtools-3.12.1-cp310-cp310-win_amd64.whl |
|---|---|
| Size | 1.7 MB |
| Tags | CPython 3.10 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
fc2adfe13ef68da76e788dc0418b673d89905b50c4621baf77b901d8a3ad31d8
|
|
BLAKE2b-256 checksum How to use checksums |
e5c78fdfbedb2713038fd86b0c40a9518b1baa4601b5d8703eb5978562c1db6b
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp310-cp310-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl
| Download URL | vdjtools-3.12.1-cp310-cp310-manylinux_2_27_x86_64.manylinux_2_28_x86_64.whl |
|---|---|
| Size | 1.8 MB |
| Tags | CPython 3.10 Linux glibc 2.27+ x86-64 Linux glibc 2.28+ x86-64 |
|
SHA-256 checksum How to use checksums |
e92f5666dd2278f9b08c7afef815a3b201b199057234406deaefc811e8b5799f
|
|
BLAKE2b-256 checksum How to use checksums |
250b1fe17fcfe7fd7990ed60ad1323baad98249eafbb07aee575592cad379f74
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency logRelease files / vdjtools-3.12.1-cp310-cp310-macosx_11_0_arm64.whl
| Download URL | vdjtools-3.12.1-cp310-cp310-macosx_11_0_arm64.whl |
|---|---|
| Size | 1.7 MB |
| Tags | CPython 3.10 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
8f6c66d1844856ec5119228f6f2ab833567812a4e01f11e1bf40a97ecaf54034
|
|
BLAKE2b-256 checksum How to use checksums |
d0b4970569206a54307c5d535e12053e732d1dc7336acf4323372c7be408ca76
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Sep 23, 2026.
Transparency log