Metagenomic binning with semi-supervised siamese neural network
Project description
SemiBin: Metagenomic Binning Using Siamese Neural Networks for short and long reads
SemiBin is a command tool for metagenomic binning with deep learning, handles both short and long reads.
CONTACT US: Please use GitHub issues for bug reports and the SemiBin users mailing-list for more open-ended discussions or questions.
If you use this software in a publication please cite:
Pan, S.; Zhu, C.; Zhao, XM.; Coelho, LP. A deep siamese neural network improves metagenome-assembled genomes in microbiome datasets across different environments. Nat Commun 13, 2326 (2022). https://doi.org/10.1038/s41467-022-29843-y
The self-supervised approach and the algorithms used for long-read datasets (as well as their benchmarking) are described in
Pan, S.; Zhao, XM; Coelho, LP. SemiBin2: self-supervised contrastive learning leads to better MAGs for short- and long-read sequencing. Bioinformatics Volume 39, Issue Supplement_1, June 2023, Pages i21–i29; https://doi.org/10.1093/bioinformatics/btad209
Basic usage of SemiBin
A tutorial of running SemiBin from scrath can be found here SemiBin tutorial.
Installation:
conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin
This will install both the SemiBin2 command as well (for backwards compatibility), the old SemiBin command. For new projects, it is recommended that you exclusively use SemiBin2: both commands do the same thing, but SemiBin2 has a slightly nicer interface.
The inputs to the SemiBin are contigs (assembled from the reads) and BAM files (reads mapping to the contigs). In the docs you can see how to generate the inputs starting with a metagenome.
Running with single-sample binning (for example: human gut samples):
SemiBin2 single_easy_bin -i contig.fa -b S1.sorted.bam -o output --environment human_gut
(if you are using contigs from long-reads, add the --sequencing-type=long_read argument).
Running with multi-sample binning:
SemiBin2 multi_easy_bin -i contig_whole.fa -b *.sorted.bam -o output
The output includes the bins in the output_bins directory (including the bin.*.fa and recluster.*.fa).
Please find more options and details below and read the docs.
Advanced Installation
SemiBin runs on Python 3.7-3.11. Python 3.12 should work as well, but not well tested yet.
Bioconda
The simplest mode is shown above. However, if you want to use SemiBin with GPU (which is faster if you have one available), you need to install PyTorch with GPU support:
conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin
conda install -c pytorch-lts pytorch torchvision torchaudio cudatoolkit=10.2 -c pytorch-lts
MacOS note: you can only install the CPU version of PyTorch in MacOS with conda and you need to install from source to take advantage of a GPU (see #72).
For more information on how to install PyTorch, see their documentation.
Source
You will need the following dependencies:
The easiest way to install the dependencies is with conda:
conda install -c bioconda bedtools hmmer samtools
Once the dependencies are installed, you can install SemiBin by running:
python setup.py install
Optional extra dependencies for running SemiBin1:
Examples of binning
SemiBin runs on single-sample, co-assembly and multi-sample binning. Here we show the simple modes as an example. For the details and examples of every SemiBin subcommand, please read the docs.
Binning assemblies from long reads
Since version 1.4, SemiBin proposes new algorithm (ensemble based DBSCAN algorithm) for binning assemblies from long reads.
To use it, you can used the subcommands bin_long or pass the option --sequencing-type=long_read to the single_easy_bin or multi_easy_bin subcommands.
Self-supervised mode
Since version 1.3, SemiBin supports completely self-supervised learning, which bypasses the need to annotate contigs with MMSeqs2.
In benchmarks, self-supervised learning is both faster (4x faster; using only 11% of RAM at peak) and generates 8.3-21.5% more high-quality bins compared to the version tested in the manuscript
To use it, pass the option --training-mode=self to the single_easy_bin or multi_easy_bin subcommands.
Easy single/co-assembly binning mode
Single sample and co-assembly are handled the same way by SemiBin.
You will need the following inputs:
- A contig file (
contig.fain the example below) - BAM file(s) from mapping short reads to the contigs, sorted (
mapped_reads.sorted.bamin the example below)
The single_easy_bin command can be used to produce results in a single step.
For example:
SemiBin2 \
single_easy_bin \
--input-fasta contig.fa \
--input-bam mapped_reads.sorted.bam \
--environment human_gut \
--output output
Alternatively, you can train a new model for that sample, by not passing in the --environment flag:
SemiBin2 \
single_easy_bin \
--input-fasta contig.fa \
--input-bam mapped_reads.sorted.bam \
--output output
The following environments are supported:
human_gutdog_gutoceansoilcat_guthuman_oralmouse_gutpig_gutbuilt_environmentwastewaterchicken_caecum(Contributed by Florian Plaza Oñate)global
The global environment can be used if none of the others is appropriate.
Note that training a new model can take a lot of time and disk space.
Some patience will be required.
If you have a lot of samples from the same environment, you can also train a new model from them and reuse it.
Easy multi-samples binning mode
The multi_easy_bin command can be used in multi-samples binning mode:
You will need the following inputs:
- A combined contig file
- BAM files from mapping
For every contig, format of the name is <sample_name>:<contig_name>, where
: is the default separator (it can be changed with the --separator
argument). NOTE: Make sure the sample names are unique and the separator
does not introduce confusion when splitting. For example:
>S1:Contig_1
AGATAATAAAGATAATAATA
>S1:Contig_2
CGAATTTATCTCAAGAACAAGAAAA
>S1:Contig_3
AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA
>S2:Contig_1
AATGATATAATACTTAATA
>S2:Contig_2
AAAATATTAAAGAAATAATGAAAGAAA
>S3:Contig_1
ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG
>S3:Contig_2
AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT
>S3:Contig_3
CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC
You can use this to get the combined contig:
SemiBin2 concatenate_fasta -i contig*.fa -o output
If either the sample or the contig names use the default separator (:), you will need to change it with the --separator,-s argument.
After mapping samples (individually) to the combined FASTA file, you can get the results with one line of code:
SemiBin2 multi_easy_bin -i concatenated.fa -b *.sorted.bam -o output
Output
The output folder will contain:
- Features computed from the data and used for training and clustering
- Saved semi-supervised deep learning model
- Output bins
- Table with basic information about each bin
- Some intermediate files
By default, reconstructed bins are in output_recluster_bins directory.
For more details about the output, read the docs.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file SemiBin-2.0.0.tar.gz.
File metadata
- Download URL: SemiBin-2.0.0.tar.gz
- Upload date:
- Size: 37.7 MB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.2 CPython/3.11.4
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
2b4ceec197b0ea2817c4e3cf6d131dd312e5605057732bfee141bbdd7025100f
|
|
| MD5 |
01dfd08de5bca1aada89586a353c8875
|
|
| BLAKE2b-256 |
a23d481e4b7b50ccde9945e04b643f9a0a51524ce8ff9bc9b3fc62a9d12c76eb
|
File details
Details for the file SemiBin-2.0.0-py3-none-any.whl.
File metadata
- Download URL: SemiBin-2.0.0-py3-none-any.whl
- Upload date:
- Size: 37.7 MB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.2 CPython/3.11.4
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
eb3a463bab9ad8a6a2d517f2d060eb514d783437ccfef2e5bd0ffb72c9eb22fb
|
|
| MD5 |
0d2c0fb710f527a0b06f26dade6728e5
|
|
| BLAKE2b-256 |
c472d48b3bfc3d8e70360dabe1b3c2a85032f2269d69ec158f5eecf1c3fe1902
|