arda — Antigen Receptor Domain Annotation
Versatile, fast, exact FR/CDR annotation of TCR and BCR sequences — mRNA and protein in FASTA, and reads in FASTQ from both amplicon and bulk RNA-seq — for nucleotide and amino-acid input, across all loci at once.
arda does the expensive IgBLAST work once, offline — building a pre-aligned
reference database of every in-frame V·J germline scaffold with FR1–4 / CDR1–3
markup — then at runtime maps your sequences to that database with MMseqs2 and
transfers the markup through the alignment in a small C++ hot path. The result
is a spec-valid AIRR Rearrangement annotation
that matches IgBLAST (98–99.7% region concordance on real GenBank mRNA), from a plain
CLI + Python library — no Docker, no workflow engine.
It also annotates records that have no read behind them — a CDR3 amino acid, a V call and a J call, as in a VDJdb row — marking up which residues each germline templates, repairing the junction, and inferring the D gene from the junction's length.
Why
IgBLAST is the gold standard but is slow to invoke per-batch and awkward to embed.
arda keeps IgBLAST-quality region calls while being:
- Fast & scalable — MMseqs2 search + a C++ projection step; on a TRA amplicon it matches MiXCR's wall clock at 3.6× less CPU and 4.8× less RSS (below); multiprocessing and SLURM-friendly from small FASTA to large FASTQ.
- Embeddable —
import arda; arda.annotate_sequences(...). - Honest — a D call is gated on an E-value that ships with it (
d_support), a germline allele with no derivable anchor is flagged rather than guessed, a junction whose Cys104 anchor is not actually in the read is not emitted, and aj_callrequires J evidence rather than being inherited from the scaffold. - Easy to install —
pip install arda-mapper(binary wheels ship the C++ extension); themmseqsbinary is fetched as a static build at runtime — no conda. IgBLAST is fetched on first use the same way, and is only needed to (re)build the reference DB or to runarda igblast, never for annotation.
Install
pip install arda-mapper # from PyPI (imports as `arda`); binary wheels ship the C++ extension
mmseqs2 (the search backend) is fetched/managed by arda at runtime. For development — and to
get the committed germline references on disk — use setup.sh:
bash setup.sh # uv .venv, fetches IgBLAST + static mmseqs, editable install
source .venv/bin/activate
Needs uv. Flags: --build-db (rebuild references after
install), --tests (run the fast suites). The committed database/vdj/<organism>/
references mean most users never need to build anything. A pip install arda-mapper
with no source checkout auto-fetches the curated references into ~/.cache/arda on
first use and builds the MMseqs2 index there — no $ARDA_HOME, no build step
(set ARDA_NO_AUTO_FETCH for air-gapped runs with a pre-populated cache).
Supported organisms: human, mouse (full IG + TR), rat, rabbit, rhesus_monkey (IG only — IgBLAST ships no TR internal annotation for these).
CLI
arda info # resolved paths + tool availability
arda annotate -i reads.fastq -o out.airr.tsv --organism human --seqtype nt
arda annotate -i prot.fasta -o out.airr.tsv --organism human --seqtype aa
arda annotate -i reads.fastq -o out.airr.tsv --strand forward # plus-strand only
arda markup -i junctions.tsv -o marked.tsv --report - # mark up + repair bare (CDR3aa, V, J) records
arda rnaseq map --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv # receptor reads out of RNA-seq
arda rnaseq map --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --junction-quality # + Phred over the junction
arda rnaseq assemble -i mapped.airr.tsv -o assembled.airr.tsv # rescue CDR3s no single read spans
arda rnaseq correct -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv
arda rnaseq correct -i mapped.airr.tsv -o clones.tsv --ec-mode accurate # quality-gated correction
arda annotate -i reads.fastq -o out.airr.tsv --d-max-evalue 0.01 # the strict D band
arda rnaseq run --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/ # one-shot map+assemble+correct
arda rnaseq slurm --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE --shards 20 --partition cpu
arda igblast -i reads.fastq -o truth.airr.tsv # gold-standard IgBLAST (all loci)
arda export-ref --kind segments --locus TRB --format fasta # the reference, out of the CLI
arda build-db --organism all # rebuild references (needs IgBLAST)
arda build-index --organism all # (re)build the precompiled mmseqs DBs
arda slurm (no rnaseq) shards FASTA into arda annotate for amplicon / single-end
work only: it drops quality and separates mates, so paired RNA-seq must use
arda rnaseq slurm, which shards Stage 1 and runs Stages 2–3 once over the merged output.
arda export-ref dumps arda's most valuable offline artifact — every in-frame V·J
scaffold with IgBLAST-quality FR1–4 / CDR1–3 coordinates — in 3 kinds × 4 formats:
arda export-ref --kind scaffolds --locus TRB --format gff3 -o trb.gff3 # V×J (and J+C) reference
arda export-ref --kind segments --locus TRB --format fasta # collapsed per-allele V/J/C
arda export-ref --kind anchors --locus TRB # per-allele CDR3 anchors (tsv)
Coordinates are 1-based closed (AIRR), so they pass through GFF3 unchanged; --format airr
shapes a scaffold as an AIRR Rearrangement row, feedable straight into anything reading arda's
own output. Details: reference export.
examples/ is a runnable tour, every artifact derived from real data committed to
this repo and regenerated by python examples/regenerate.py: one real mRNA per locus; the two
human reads (of 7,341, across five organisms) that carry a tandem D-D; seven VDJdb records
covering every junction-repair outcome; and a 1,035-read FASTQ that runs the whole bulk RNA-seq
pipeline in ~6 s. See CHANGELOG.md for what changed per release.
Input may be FASTA or FASTQ, plain or gzipped. Nucleotide input is searched on both strands
by default (reverse-complement reads are re-oriented and flagged rev_comp=T); a single search
annotates a mixed bulk RNA-seq file across all loci.
Amplicon vs bulk RNA-seq: which mode
The speed flags are regime-specific, and picking the wrong one is slower than picking none.
--two-pass --fast-segments --v-only-on-segment= the AMPLICON configuration
--prefilter= the BULK configurationThey do NOT compose.
--two-passALONE is a LOSS: 0.762× on bulk, 0.87× on an IGH amplicon.
# AMPLICON / RepSeq (reads span V into J)
arda rnaseq run --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/ \
--two-pass --fast-segments --v-only-on-segment
# BULK RNA-seq (1-5 % of reads are receptor-derived)
arda rnaseq run --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/ --prefilter
The predictor is not the library's name but whether a read hits both a V and a J segment —
fast_fraction in the run report. Primer-anchored amplicon reads do; bulk reads land anywhere
in a transcript and mostly do not, which is why the segment path is overhead there and the
16-mer prefilter (a scan-term optimisation) is the bulk lever instead. All four flags are off by
default. --indel-rescue (with --fast-segments) reroutes indel-bearing reads to the gapped
path; its value tracks SHM load, so it is a per-library call. Details and the per-flag
measurements: arda rnaseq map --help and the
usage guide.
Accuracy regimes: which knob for which question
Separate from the speed flags, and set from what you are going to do with the answer. All are off by default; the shipped output does not move unless you ask.
| question | flags | what it buys |
|---|---|---|
| Repertoire-level D usage | (default, E ≤ 0.2) |
highest D recall |
| A D call you will act on, or a tandem D-D you will report | --d-max-evalue 0.01 |
gene agreement vs IgBLAST .9765 → .9985 (TRB amplicon), at ~⅓ the call rate |
| Low-frequency variant recovery (spike-in, MRD, monoclonal control) | map --junction-quality + correct --error-rate 1e-5 --ec-mode accurate |
keeps both published MIGEC spike-ins and monoclonal purity .96034 → .99530 |
| SHM / lineage trees | (default) | v_mutations/j_mutations in germline coordinates, +36 ms per 100 k reads |
--d-max-evalue is a recall/precision dial, not a bug fix: the shipped 0.2 is deliberately the
loosest band, because dropping two thirds of the D calls is the wrong default for a repertoire
tool. --ec-mode accurate is --min-junction-q 20 — it judges the one base that discriminates a
clonotype from its parent on its Phred score rather than on abundance, which is a measurement
the abundance model does not have. Depth: D segments,
SHM,
error correction.
Performance
Head-to-head, same input and same job
TRA amplicon, 100,000 reads, 8 threads.
| tool | config | wall (s) | CPU (s) | peak RSS (MB) |
|---|---|---|---|---|
| arda 2.11.1 | --two-pass --fast-segments --v-only-on-segment |
5.35 | 12.73 | 631 |
| MiXCR 4.7.0 | align --preset rna-seq --species hsa |
5.90 | 45.24 | 3,027 |
arda is 1.10× faster on wall clock at 3.6× less CPU and 4.8× less RSS — the wall figures are close, the resource figures are not, which is what matters when many samples share a node.
Bulk RNA-seq, 100,000 reads.
| tool | wall (s) | CPU (s) | peak RSS (MB) | what it produced |
|---|---|---|---|---|
| arda 2.11.1 | 2.51 | 5.4 | 234 | AIRR record per read, with junction |
| MiXCR 4.7.0 | 4.54 | 31.8 | 3,022 | AIRR record per read, with junction |
| TRUST4 | 1.91 | 4.36 | 192 | candidate read extraction only |
⚠ TRUST4's stage here is candidate extraction, not a per-read AIRR record with a junction — it is doing less work, so the three rows are not like-for-like.
IGH RepSeq amplicon, 100,000 pairs, 32 threads. What the amplicon configuration is worth against the shipped one-pass default on hypermutated IGH:
| dataset | config | wall (s) | peak RSS (MB) |
|---|---|---|---|
| IGH_repertoire | one-pass default | 316.44 | 4,018 |
| IGH_repertoire | --two-pass --fast-segments --v-only-on-segment |
76.25 | 1,479 |
| IGH_naive | one-pass default | 305.32 | 3,736 |
| IGH_naive | --two-pass --fast-segments --v-only-on-segment |
64.86 | 1,363 |
4.15× and 4.71×, at ~2.7× less memory.
Synthetic benchmarks vs IgBLAST
⚠ The two tables below are synthetic — generated human IGH sequences, not a real library —
from scripts/bench_vs_igblast.py and
scripts/bench_prefilter.py. They measure scaling shape, not
head-to-head standing; use the tables above for that. 16 threads.
| sequences | arda wall | arda rate | speedup vs IgBLAST | region concordance |
|---|---|---|---|---|
| 10,000 | 5.5 s | ~1.8k/s | 4.4× | 98.9% |
| 50,000 | 16 s | ~3.0k/s | 7.3× | |
| 100,000 | 30 s | ~3.3k/s | 7.9× |
Bulk RNA-seq is faster per read than amplicon, because mmseqs prefilters by k-mer matching — reads with no receptor k-mer are rejected before alignment. 150 nt reads, 16 threads:
| receptor content | throughput |
|---|---|
| 100% (amplicon) | ~5.7k reads/s |
| 10% | ~19k reads/s |
| 1% (blood RNA-seq) | ~25k reads/s |
Memory
arda is CPU-bound; large FASTQ is streamed in bounded chunks (a background reader prefetches
the next chunk while the current one is annotated), so mapping is flat at ~300–650 MB at any
read depth. Peak RSS tracks repertoire richness, not reads: Stage 3 holds the clone set, so
on a B-cell-rich tumour (28,444 clonotypes from 105 M reads) correct peaked at 2,071.7 MB,
while a colder sample with more reads (139 M) peaked at 549 MB. Budget ~4 GB, and size a
SLURM --mem from Stage 3, never Stage 1.
Accuracy
Against an IgBLAST truth on a TRA amplicon, 100,000 reads:
| metric | arda 2.11.1 | MiXCR 4.7.0 |
|---|---|---|
| v_gene recall | .9867 | .9973 |
| v_gene precision | .9996 | .9978 |
| v_allele resolved | .9868 | n/a |
| j_gene recall | .9892 | .9904 |
| j_gene precision | .9953 | .9995 |
| junction precision, among emitted | .99919 | .99991 |
arda's V calls are the more precise of the two: it declines rather than guessing. MiXCR
suffixes every allele *00, i.e. it makes no allele call at all, so v_allele has no comparator.
Score alleles as tie lists, not exact strings. IgBLAST and arda both return an ambiguous
allele as a comma-joined set; scoring that as a miss is a scoring artifact, not an error. Across
25 datasets the median is v_allele_exact .8328 against v_allele_resolved .9763 —
14 points of the apparent gap is the scoring rule.
A V/J boundary disagreement inside the junction is not an error. V(D)J recombination is probabilistic: exonuclease chew-back and N/P-nucleotide addition mean the V-end / N-D-N / J-start partition is often not identifiable from sequence alone, so overlapping V/J/NDN assignments are acceptable and the ground truth is unknown. What is checkable, and what the table scores: the junction's outer bounds (Cys104 and [FW]118), the gene/allele calls, and whether a tool invents a junction it has no anchor for.
On ~7.3k real GenBank mRNA records spanning all five organisms and their loci (committed,
gzipped test fixtures), region concordance with IgBLAST on productive records is 98–99.7% per
organism, and junction_aa/cdr3_aa match IgBLAST ~99% while satisfying the AIRR invariants
exactly. (GenBank also contains genomic/partial/non-productive entries that confuse both tools;
those are excluded.)
Bulk RNA-seq mode
arda rnaseq is a recall-first pipeline for extracting the repertoire from bulk RNA-seq, where
1–5% of reads are receptor-derived:
arda rnaseq map --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --report run.json
arda rnaseq assemble -i mapped.airr.tsv -o assembled.airr.tsv
arda rnaseq correct -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv
--extra-airr is what folds Stage 3 back in; without it the assembled reads are silently
discarded. arda rnaseq run does all three in one call and wires it for you.
mapstreams paired FASTQ, keeps only reads mapping to a receptor scaffold, and writes them as AIRR. The reference includesJ + Cconstant-region scaffolds, so a read spanning the J→C splice — which ends in the constant region and has no V to anchor — still maps and carries ac_call(the CH1 exon) plus ac_classisotype (IGHG/IGHM/IGHA… — the class, never the noise-prone subclass). In paired mode the isotype of a CDR3-bearing read is recovered from its constant-region mate.--reconstructmerges each overlapping mate pair into one fragment, resolving overlap mismatches by the higher-Phred base.assemblereconstructs clonotypes whose CDR3 is too long for any single 100–150 bp read to span (V(DD)J ultralong, ~20–40 aa) by greedy overlap-extension anchored on Stage-1's per-readcdr3_start.correctaggregates reads into clonotypes and collapses sequencing-error CDR3 variants. Abundance is the AIRRduplicate_count— every read that encompasses the junction, the true expression estimate — withconsensus_countfor distinct fragments.
arda igblast -i reads.fastq -o truth.airr.tsv runs IgBLAST across all loci as a gold-standard
reference for benchmarking (see the arda-benchmark project).
Error correction: --error-rate is a per-library calibration
correct's error model is per-base with a length-scaled threshold (a mismatch over a longer
junction is likelier an error) and is SHM-indel-tolerant. Its one knob is --error-rate, and the
default (1e-3, ~Phred 30) is not universally safe:
On the MIGEC spike-in library (PRJNA239303), at the default --error-rate 1e-3 arda erases both
published spike-in variants. That is a signal-to-noise limit, not a defect: on the paper's own
metric computed over raw reads, V1/Err1 = 1.35 and V2/Err2 = 0.28 — the second variant is
less abundant than the worst 2-substitution PCR error in the same library, so no
abundance-based method, at any threshold, can separate them. That is precisely why UMI
consensus exists; it moves V1/Err1 to 26–76 before any correction runs.
What to do about it:
arda rnaseq correct -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv --error-rate 1e-5
1e-5 recovers both spike-in variants exactly. On an independent error cloud, 1e-4 kept both
while still removing 72% of the real PCR errors. --error-rate has a physical reading — ~1e-3
for raw reads (the sequencer's Phred-30 substitution rate) and ~1e-5 for UMI-consensus input
— so calibrate per library rather than trusting one default.
And it no longer has to cost precision. 1e-5 used to buy the variants at 3.5 points of
purity on a monoclonal control (.99540 → .96034), because it also stops collapsing real PCR error.
correct --min-junction-q gates on the Phred score of the one base that discriminates a clonotype
from its putative parent — a measurement abundance does not have, and one that separates cleanly
(the published spike-ins read median Q 34–35 there, the error cloud around them median Q 24):
arda rnaseq map --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --junction-quality
arda rnaseq correct -i mapped.airr.tsv -o clones.tsv --error-rate 1e-5 --ec-mode accurate
Both variants kept, monoclonal purity back to .99530, spurious junctions 297 → 62, distinct
error clonotypes 1,630 → 124. What it cannot do is rescue a variant below the template-error
floor: RT and early-PCR errors happen before the UMI is attached, so consensus cannot remove
them and they are high-Q by construction. Full write-up, including why binom/betabinom are not
accurate: error correction.
Library
import arda
records = arda.annotate_sequences(
["GACGTGCAG...", ("clone7", "CAGGTG...")], # strings or (id, seq) pairs
seqtype="nt", organism="human",
)
# -> list of AIRR record dicts: v_call, d_call/d2_call, j_call, c_call/c_class,
# fwr1..fwr4, cdr1..cdr3, *_start/*_end (1-based closed), *_aa, junction(_aa),
# np1/np2/np3, d_support/d2_support, {v,j,c,d}_cigar, v_mutations/j_mutations,
# sequence_alignment, germline_alignment, productive, ...
# The TSV is a spec-valid AIRR Rearrangement file (passes airr.schema validation).
Records with no read behind them
A VDJdb row is a CDR3 amino acid, a V call and a J call. There is nothing to align, but the germlines still template a known run of residues into each end of the junction:
from arda.cdr3fix import markup_cdr3
from arda.annotate.dmap import map_d_junction
from arda.dpost import posterior_d
mk = markup_cdr3("CAIRDDKII", "TRAV12-3*01", "TRAJ30*01", "HomoSapiens")
mk.cdr3_repaired # 'CAIRDDKIIF' -- the Phe118 anchor restored
[str(e) for e in mk.errors] # ["J del@8 missing 'F' d=0"]
mk.good # True: both sides repaired, both anchors present
junction_nt = "TGTGCTCTTGGGCCCCGGCCTTCCTACAGCGAGGAGTTGGGGGATACCCATCGGGCCGATAAACTCATCTTT"
map_d_junction(junction_nt, "TRDV1*01", "TRDJ1*01", "human").d2_call # 'TRDD3*01' (tandem D-D)
posterior_d("CASSPLGQAYEQYF", "TRBV5-1*01", "TRBJ2-7*01", "human").d_call # 'TRBD1'
Coordinates here are junction space — Cys104 through Phe/Trp118, both anchors
included. That is what VDJdb's cdr3 column holds, and it is not arda's cdr3 field,
which excludes both. Conflating them silently corrupts every coordinate.
Repair is conservative: only edits adjacent to a conserved anchor are applied, everything deeper is reported and left alone, and a repair is refused outright unless the result opens with Cys104 and closes with Phe/Trp118.
Annotating bare germline segments
There is no coverage filter, so a V-only or J-only query maps to its scaffold and only
the regions inside the query's coverage are returned — a bare V yields fwr1..fwr3, a bare J
yields fwr4:
from arda.annotate.mapper import annotate_records
recs = annotate_records(
[("TRBV9*01", v_germline_nt), ("TRBJ2-7*01", j_germline_nt)],
organism="human", seqtype="nt", strand="forward", map_d=False,
)
(mirpy uses exactly this to bake per-allele FR/CDR subsequences into its gene library; see
tests/synthetic/test_germline_segments.py. arda export-ref is the CLI equivalent.)
How it works
-
Reference build (
arda.refbuild, offline): download IMGT/V-QUEST germlines → enumerate deduplicated in-frame V×J scaffolds (D only affects CDR3 interior, so it isn't enumerated) plusJ + Cconstant-region scaffolds (the CH1 exon spliced onto each J, so J→C reads have somewhere to land) → annotate withigblastn -outfmt 19→ translate → writedatabase/vdj/<organism>/{alleles.fasta, alleles.aa.fasta, markup.tsv, markup.aa.tsv, combinations.tsv, d_germlines.fasta, cdr3_anchors.tsv, d_prior.tsv, build.log}. -
Runtime (
arda.annotate): MMseqs2 search query→scaffolds → best hit → C++transfer_regionsprojects scaffold region coordinates onto the query (handling indels, truncation, mid-codon alignment starts, reverse strand) → for VDJ loci a gapless C++ local alignment of the CDR3 interior against the D germlines addsd_call/d2_call+np*; a hit on aJ + Cscaffold addsc_call/c_class→ AIRR TSV. Ambiguous D and C calls are comma-joined allele lists, as V/J already are. Out-of-frame junctions are reported with an N-bridge (_) so FR4 still reads.The V..J interior is bounded by the per-allele junction anchors in
cdr3_anchors.tsv, not by the scaffold projection — a scaffold has a 9 nt N-pad where a read has a 20–40 nt N-D-N region, so the projection collapses the very window the D lives in. A junction is emitted only when the read actually reaches its Cys104 anchor. The D call is accepted on a Karlin–Altschul E-value (d_support, re-thresholdable with--d-max-evalue) rather than a per-locus score floor, and is constrained by germline geometry before the statistics:/ORorphons sit outside the locus and cannot rearrange at all; TRBD2 lies 3′ of the entire TRBJ1 cluster, so a TRBJ1 rearrangement can never be assigned TRBD2; and a tandem D-D must run in genomic 5′→3′ order, since deletional joining cannot produce any other. D mapping also runs on--seqtype aa, against each D germline's three translated frames. -
Bare records (
arda.cdr3fix,arda.dpost): a VDJdb-style row — CDR3 amino acid, V, J, species, and no read — is marked up against the same anchors (arda markup), its errors located and conservatively repaired, and optionally given a D gene inferred from the junction length (--d-posterior).
Fast sequence primitives (translate, detect_coding_frame, reverse_complement,
back_translate) live in the C++ extension and are re-exported from
arda.refbuild.translate — mirpy-API-compatible, so mirpy can import arda and reuse them.
The reference ships with precompiled MMseqs2 indexes (database/vdj/<organism>/mmseqs/),
used automatically when the local MMseqs2 version matches; otherwise arda transparently
rebuilds a private cache on first run (arda build-index regenerates the shipped DBs).
segments.fasta — the collapsed per-allele reference the two-pass path uses — is generated,
not shipped, and is built on demand when missing.
Pipeline integration
arda rnaseq run writes <prefix>.clones.tsv (AIRR clonotypes), <prefix>.airr.tsv (mapped
reads), <prefix>.assembled.airr.tsv and <prefix>.arda.json (run report). Because it is a
plain CLI over named files, it drops into any workflow engine with no glue code.
A ready-to-use Nextflow module lives in integrations/nextflow/arda/:
copy it to modules/local/arda/, feed it the trimmed per-sample FASTQ channel the aligners
already use, and it publishes per-sample clonotype tables to ${params.outdir}/arda/. It ships a
conda environment.yml (works with -profile conda) and a Dockerfile, and emits a
versions.yml. See its README and the
pipeline-integration guide.
Roadmap / TODO
See ROADMAP.md for the full list. Done: the V·J reference build across
5 organisms, MMseqs2 mapping with C++ markup transfer, all-loci querying, streaming I/O,
D-segment mapping incl. D-D fusions (nt and aa input, E-value gated, genomic-order
constrained), constant-region J + C scaffolds (c_call/c_class isotype), bulk
RNA-seq mode with long-CDR3 contig assembly and coverage-based expression, junction
markup + repair on bare records, multi-node (SLURM) sharding, the segment-based
fast paths (--two-pass, --fast-segments, --v-only-on-segment, --prefilter,
--indel-rescue), per-segment SHM in germline coordinates (v_mutations/j_mutations),
quality-gated error correction (--junction-quality, --min-junction-q, --ec-mode)
and arda export-ref.
Next: full-depth clonotype benchmarking; a segment-native per-read path that removes MMseqs2
from the amplicon hot loop; and an arda.hmm semi-Markov model of V→N→D→N→J that would
subsume the E-value gate, the genomic-order constraint and the D posterior into one
forward–backward pass.
Development
pip install -e . # rebuilds the C++ ext on import
python -m pytest tests/unit tests/synthetic -q # fast suite (needs mmseqs)
python -m pytest tests/realworld -q # vs IgBLAST, on committed fixtures — offline
env RUN_BENCHMARK=1 python -m pytest tests/benchmark -s # timing/memory/scaling
Optional extras gate optional suites: .[groundtruth] (olga) for the generative ground-truth
tests that keep arda.cdr3fix honest, .[test] for airr schema validation. Without them those
tests skip, so pip install -e '.[test]' before reading a green suite as full coverage.
Layout: src/arda/{refbuild,annotate}, C++ in src/_markup/markup.cpp and
src/_segmap/segmap.cpp, references in database/, downloads in gitignored bin/ + data/.
Release files for arda-mapper 2.13.0
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| arda_mapper-2.13.0.tar.gz | 9.5 MB | Details |
Built distributions (wheels)
Total release size: 17.2 MB
Release files / arda_mapper-2.13.0.tar.gz
| Download URL | arda_mapper-2.13.0.tar.gz |
|---|---|
| Size | 9.5 MB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
0d137a899c8f15069f40a36e2cc3696de858e06dd95ee0b896ea38671c6c4ffd
|
|
BLAKE2b-256 checksum How to use checksums |
ef89a080e38aa8e2a8693010fcd36a0688a4368a56d7af73482cd855dff5763b
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp313-cp313-win_amd64.whl
| Download URL | arda_mapper-2.13.0-cp313-cp313-win_amd64.whl |
|---|---|
| Size | 648.1 kB |
| Tags | CPython 3.13 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
ef8b2d3cb2915a5b4f600486a9960138b6850a5828e9b3eeb404a6e73815547a
|
|
BLAKE2b-256 checksum How to use checksums |
1c13f8cf09eb040fde41d8fd9f55309a68caa19767ee9b9dd10a8db6fbef96af
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | arda_mapper-2.13.0-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 711.7 kB |
| Tags | CPython 3.13 Linux glibc 2.17+ x86-64 |
|
SHA-256 checksum How to use checksums |
bf27f7026a23cfbcb1fc30966f25917ac8d215ec5ff6fbad19513a00befdea14
|
|
BLAKE2b-256 checksum How to use checksums |
5c7caeefdaa3c83f658aa96f1bb9e5c08ffe0ae937a51b7d085ddaf581e70657
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp313-cp313-macosx_11_0_arm64.whl
| Download URL | arda_mapper-2.13.0-cp313-cp313-macosx_11_0_arm64.whl |
|---|---|
| Size | 562.8 kB |
| Tags | CPython 3.13 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
ba1f431d05f0bbbe4eef6b9ad86d062216567bf9dc73ab0fb0ea32c27d5cd759
|
|
BLAKE2b-256 checksum How to use checksums |
c12fe5f6b5674fed37910d5b54c690e4c8a4a72309d23afdb371a3a9efde4068
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp312-cp312-win_amd64.whl
| Download URL | arda_mapper-2.13.0-cp312-cp312-win_amd64.whl |
|---|---|
| Size | 648.0 kB |
| Tags | CPython 3.12 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
14a7537b8034763169ea90190ac8693c341ee3e29ab65be6958145053b0b8508
|
|
BLAKE2b-256 checksum How to use checksums |
a51cef92ca4ca9005631c44a1a962971a56bbde61b4a3c35b4de7f4ddcf0868e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | arda_mapper-2.13.0-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 711.7 kB |
| Tags | CPython 3.12 Linux glibc 2.17+ x86-64 |
|
SHA-256 checksum How to use checksums |
4469500adf4fb73cab55599f5a065ccc2a85373f9aa1fce217663ba19f60f454
|
|
BLAKE2b-256 checksum How to use checksums |
d3ab573ba232658d47b42c1cd275883ed5a205a8c3089714894448194c1258d4
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp312-cp312-macosx_11_0_arm64.whl
| Download URL | arda_mapper-2.13.0-cp312-cp312-macosx_11_0_arm64.whl |
|---|---|
| Size | 562.6 kB |
| Tags | CPython 3.12 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
d53161c69bcd75e5a622a8a57467c6f744050b65c3f33a8722e6a43c8ae8f1b1
|
|
BLAKE2b-256 checksum How to use checksums |
1f067607a05be20fbe6ca9ad2325032008df4657d28354282d1a3fbfa06db8c8
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp311-cp311-win_amd64.whl
| Download URL | arda_mapper-2.13.0-cp311-cp311-win_amd64.whl |
|---|---|
| Size | 641.3 kB |
| Tags | CPython 3.11 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
759a9b5eb85aa1b517b051502c6a7af5eed36d0d4b4f941d2d0017194fff26d4
|
|
BLAKE2b-256 checksum How to use checksums |
2ffd5dd8dd4cbb9d606ac628a6975a897d8764d45e2169299cf085969d9f3fa1
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | arda_mapper-2.13.0-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 717.3 kB |
| Tags | CPython 3.11 Linux glibc 2.17+ x86-64 |
|
SHA-256 checksum How to use checksums |
1a4e47d981fd956c882376d0d4b42a99795b760ea6e8c460ac9e455f73bf1975
|
|
BLAKE2b-256 checksum How to use checksums |
9fe0660280536d33eee543fbfd72fb37cf601ef7927acc4c14b507c02d11d078
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp311-cp311-macosx_11_0_arm64.whl
| Download URL | arda_mapper-2.13.0-cp311-cp311-macosx_11_0_arm64.whl |
|---|---|
| Size | 561.6 kB |
| Tags | CPython 3.11 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
eefb6e92691ebef0159fcfa338a85e4b16a802bfbe02da50f8c978a904123b4d
|
|
BLAKE2b-256 checksum How to use checksums |
5055e7f27587dc827c9848a6e8c478bb66258959bd11c6be371dd226e035eb50
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp310-cp310-win_amd64.whl
| Download URL | arda_mapper-2.13.0-cp310-cp310-win_amd64.whl |
|---|---|
| Size | 637.4 kB |
| Tags | CPython 3.10 Windows x86-64 |
|
SHA-256 checksum How to use checksums |
dd52df64ea64075e285f97bd5cfeb1ce9a1d9028ac2833187292d418f8954125
|
|
BLAKE2b-256 checksum How to use checksums |
aa120d61c6321f9562d14262613f3841f0689f6a8b3cb5415a21f8cfe1108762
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
| Download URL | arda_mapper-2.13.0-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl |
|---|---|
| Size | 711.4 kB |
| Tags | CPython 3.10 Linux glibc 2.17+ x86-64 |
|
SHA-256 checksum How to use checksums |
7988d5025a800614af3273c2262414a20db303ec214e1d9d9d88efe891b0df88
|
|
BLAKE2b-256 checksum How to use checksums |
9f61585c890621f77b4d13e9987007b049cc4532716f3471b6c12a732f244f31
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency logRelease files / arda_mapper-2.13.0-cp310-cp310-macosx_11_0_arm64.whl
| Download URL | arda_mapper-2.13.0-cp310-cp310-macosx_11_0_arm64.whl |
|---|---|
| Size | 556.9 kB |
| Tags | CPython 3.10 macOS 11.0+ ARM64 |
|
SHA-256 checksum How to use checksums |
db8f86be0ff4a4bc32a4ed242f44f4e5637c1ce3f2fb062f281aee4eda1702bc
|
|
BLAKE2b-256 checksum How to use checksums |
3699351cafe439c2647712c37cf434fa274ba2a5c9413a28c17328526a1d194e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
Yes |
| Uploaded via |
twine/7.0.0 CPython/3.13.14
|
Provenance
Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.
PyPI Publish Attestation
PyPI verified that this artifact, at this checksum, originated from the publisher listed below.
Signed by GitHub Actions, verified by PyPI on Aug 8, 2026.
Transparency log