Skip to main content

arda

arda — Antigen Receptor Domain Annotation

PyPI CI docs python license

Versatile, fast, exact FR/CDR annotation of TCR and BCR sequences — mRNA and protein in FASTA, and reads in FASTQ from both amplicon and bulk RNA-seq — for nucleotide and amino-acid input, across all loci at once.

arda does the expensive IgBLAST work once, offline — building a pre-aligned reference database of every in-frame V·J germline scaffold with FR1–4 / CDR1–3 markup — then at runtime maps your sequences to that database with MMseqs2 and transfers the markup through the alignment in a small C++ hot path. The result is a spec-valid AIRR Rearrangement annotation that matches IgBLAST (98–99.7% region concordance on real GenBank mRNA), from a plain CLI + Python library — no Docker, no workflow engine.

It also annotates records that have no read behind them — a CDR3 amino acid, a V call and a J call, as in a VDJdb row — marking up which residues each germline templates, repairing the junction, and inferring the D gene from the junction's length.

Why

IgBLAST is the gold standard but is slow to invoke per-batch and awkward to embed. arda keeps IgBLAST-quality region calls while being:

  • Fast & scalable — MMseqs2 search + a C++ projection step; on a TRA amplicon it matches MiXCR's wall clock at 3.6× less CPU and 4.8× less RSS (below); multiprocessing and SLURM-friendly from small FASTA to large FASTQ.
  • Embeddableimport arda; arda.annotate_sequences(...).
  • Honest — a D call is gated on an E-value that ships with it (d_support), a germline allele with no derivable anchor is flagged rather than guessed, a junction whose Cys104 anchor is not actually in the read is not emitted, and a j_call requires J evidence rather than being inherited from the scaffold.
  • Easy to installpip install arda-mapper (binary wheels ship the C++ extension); the mmseqs binary is fetched as a static build at runtime — no conda. IgBLAST is fetched on first use the same way, and is only needed to (re)build the reference DB or to run arda igblast, never for annotation.

Install

pip install arda-mapper   # from PyPI (imports as `arda`); binary wheels ship the C++ extension

mmseqs2 (the search backend) is fetched/managed by arda at runtime. For development — and to get the committed germline references on disk — use setup.sh:

bash setup.sh            # uv .venv, builds the C++ extensions, fetches IgBLAST + static mmseqs
source .venv/bin/activate

Needs uv. Flags: --build-db (rebuild references after install), --tests (run the unit + synthetic suites — and fail if they fail). It installs .[test,dev], wipes any stale build/ first, and then verifies three things that a bare import arda does not: that _markup, _segmap and _denoise actually compiled (arda falls back to a pure-Python markup path otherwise, so a failed build looks like a successful install and surfaces later as a silent slowdown), that mmseqs resolves, and that every mode and stage command resolves on the CLI. The committed database/vdj/<organism>/ references mean most users never need to build anything. A pip install arda-mapper with no source checkout auto-fetches the curated references into ~/.cache/arda on first use and builds the MMseqs2 index there — no $ARDA_HOME, no build step (set ARDA_NO_AUTO_FETCH for air-gapped runs with a pre-populated cache).

Supported organisms: human, mouse (full IG + TR), rat, rabbit, rhesus_monkey (IG only — IgBLAST ships no TR internal annotation for these).

CLI

Three modes, named after the library — each owns the speed configuration that regime needs:

arda rnaseq   --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/   # bulk / whole-transcriptome
arda amplicon --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/   # targeted RepSeq / 5'RACE
arda singlecell                                               # reserved — not implemented yet

Each runs mapassemblecorrect and writes <prefix>.airr.tsv, <prefix>.clones.tsv, <prefix>.assembled.airr.tsv and <prefix>.arda.json. --exact turns every speedup off.

The stages are separate commands, so any one can be run, inspected or replaced:

arda map      --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv   # Stage 1: receptor reads out of RNA-seq
arda map      --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --junction-quality  # + Phred over the junction
arda assemble -i mapped.airr.tsv -o assembled.airr.tsv         # Stage 3: CDR3s no single read spans
arda correct  -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv   # Stage 2: clonotypes
arda correct  -i mapped.airr.tsv -o clones.tsv --ec-mode accurate    # quality-gated correction
arda correct  -i mapped.airr.tsv -o clones.tsv --call-level gene     # collapse allele-level call splits
arda shm      -i mapped.airr.tsv -o rescoped.airr.tsv          # recount SHM outside the junction

Everything else:

arda info                                   # resolved paths + tool availability
arda annotate -i reads.fastq -o out.airr.tsv --organism human --seqtype nt
arda annotate -i prot.fasta  -o out.airr.tsv --organism human --seqtype aa
arda annotate -i reads.fastq -o out.airr.tsv --strand forward   # plus-strand only
arda annotate -i reads.fastq -o out.airr.tsv --d-max-evalue 0.01  # the strict D band
arda markup -i junctions.tsv -o marked.tsv --report -           # mark up + repair bare (CDR3aa, V, J) records
arda resolve-ties -i mapped.airr.tsv -o widened.airr.tsv        # every germline the read cannot rule out
arda cluster submit --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE --shards 20 --partition cpu
arda igblast -i reads.fastq -o truth.airr.tsv                   # gold-standard IgBLAST (all loci)
arda export-ref --kind segments --locus TRB --format fasta      # the reference, out of the CLI
arda build-db   --organism all              # rebuild references (needs IgBLAST)
arda build-index --organism all             # (re)build the precompiled mmseqs DBs

arda cluster holds every sharded/SLURM helper. arda cluster submit shards Stage 1 across an array and runs Stages 2–3 once over the merged output — byte-identical to a single-node run. arda cluster split-fasta / submit-fasta are the amplicon / single-end FASTA path: they drop quality and separate mates, so paired RNA-seq must not use them.

arda export-ref dumps arda's most valuable offline artifact — every in-frame V·J scaffold with IgBLAST-quality FR1–4 / CDR1–3 coordinates — in 3 kinds × 4 formats:

arda export-ref --kind scaffolds --locus TRB --format gff3 -o trb.gff3   # V×J (and J+C) reference
arda export-ref --kind segments  --locus TRB --format fasta              # collapsed per-allele V/J/C
arda export-ref --kind anchors   --locus TRB                             # per-allele CDR3 anchors (tsv)

Coordinates are 1-based closed (AIRR), so they pass through GFF3 unchanged; --format airr shapes a scaffold as an AIRR Rearrangement row, feedable straight into anything reading arda's own output. Details: reference export.

examples/ is a runnable tour, every artifact derived from real data committed to this repo and regenerated by python examples/regenerate.py: one real mRNA per locus; the two human reads (of 7,341, across five organisms) that carry a tandem D-D; seven VDJdb records covering every junction-repair outcome; and a 1,035-read FASTQ that runs the whole bulk RNA-seq pipeline in ~6 s. See CHANGELOG.md for what changed per release.

Input may be FASTA or FASTQ, plain or gzipped. Nucleotide input is searched on both strands by default (reverse-complement reads are re-oriented and flagged rev_comp=T); a single search annotates a mixed bulk RNA-seq file across all loci.

Modes: pick the command, not the flags

The speed configurations are regime-specific and do not compose, and picking the wrong one is slower than picking none. So the regime is the command name, and arda owns what it implies:

command for speed configuration denoising default
arda rnaseq whole-transcriptome bulk RNA-seq (0.02–3 % receptor) --prefilter --ec-mode rnaseq
arda amplicon targeted RepSeq / 5′RACE (reads span V into J) --two-pass --fast-segments --v-only-on-segment --ec-mode amplicon
arda singlecell reserved — not implemented
arda amplicon --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/
arda rnaseq   --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/
arda rnaseq   --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/ --exact   # no speedups at all

⛔ Until 2.16.0 the only entry point was arda rnaseq run, used for amplicon as well, with the regime spelled out as four loose flags. --two-pass alone is a LOSS — 0.762× on bulk, 0.87× on an IGH amplicon — and it was the one flag that entry point exposed for four releases. Naming the mode makes the dominated combination unreachable by accident. arda rnaseq run no longer exists.

The predictor is not the library's name but whether a read hits both a V and a J segment — fast_fraction in the run report. Primer-anchored amplicon reads do; bulk reads land anywhere in a transcript and mostly do not, which is why the segment path is overhead there and the 16-mer prefilter (a scan-term optimisation) is the bulk lever instead.

arda rnaseq enables --prefilter, which costs ~0.15 % of mapped reads (122 bulk datasets; up to 2.46 % on one library), concentrated in J→C and hypermutated IGH. Use --exact where that matters. --indel-rescue (amplicon only) reroutes indel-bearing reads to the gapped path; its value tracks SHM load, so it stays a per-library call and never rides the preset — and arda now refuses it outside the amplicon mode rather than ignoring it. Per-flag measurements: arda amplicon --help, arda map --help and the usage guide.

Stages, and the flags that select them

mapassemblecorrect are separate commands as well as stages inside a mode:

stage / flag what it does
--assemble (default on) contig assembly for long CDR3s no single 100–150 bp read spans; recovers ~95 % of the abundant long clones a filter-only pass misses
--shm framework (default) SHM (v_identity, v_mutations, j_mutations) scoped outside the junction — IGH/IGK/IGL is where it is real
--shm both also emit the pre-2.16.0 junction-inclusive values as *_full columns
--isotype (default on) IGH isotype: c_call/c_class, voted per fragment then per clonotype, reported as class never subclass
--call-level gene drop the allele suffix before the clonotype key, collapsing allele-level call splits
--map-d (default on) D and tandem D-D alignment into the junction

arda shm -i in.airr.tsv -o out.airr.tsv does the SHM recount standalone, needing no reference and no re-map — the germline anchors are already in the file.

Accuracy regimes: which knob for which question

Separate from the speed flags, and set from what you are going to do with the answer. All are off by default; the shipped output does not move unless you ask.

question flags what it buys
Repertoire-level D usage (default, E ≤ 0.2) highest D recall
A D call you will act on, or a tandem D-D you will report --d-max-evalue 0.01 gene agreement vs IgBLAST .9765 → .9985 (TRB amplicon), at ~⅓ the call rate
Low-frequency variant recovery (spike-in, MRD, monoclonal control) map --junction-quality + correct --error-rate 1e-5 --ec-mode accurate keeps both published MIGEC spike-ins and monoclonal purity .96034 → .99530
SHM / lineage trees (default) v_mutations/j_mutations in germline coordinates, +36 ms per 100 k reads
Monoclonal QC / cell-line purity --ec-mode amplicon --clonotype-key junction Jurkat 90 → 10 clonotypes, TRB purity .98963 → .99990, reads unchanged at 14,531, and 98.50 % of them on the two published clones
A targeted library that is deep --ec-mode amplicon quality-directed rescue at 12 subs / 50× — reaches the class the abundance model structurally cannot
Bulk RNA-seq, where singletons are mostly real --ec-mode rnaseq the same rescue kept narrow (6 subs / 200×)

--d-max-evalue is a recall/precision dial, not a bug fix: the shipped 0.2 is deliberately the loosest band, because dropping two thirds of the D calls is the wrong default for a repertoire tool. --ec-mode accurate is --min-junction-q 20 — it judges the one base that discriminates a clonotype from its parent on its Phred score rather than on abundance, which is a measurement the abundance model does not have.

Every denoising mode MOVES reads onto a parent and never discards them — the sum of duplicate_count is invariant across modes, and a clonotype with no qualifying parent keeps its reads and is reported as an orphan. That is not caution: on a polyclonal hypermutated repertoire a plain quality filter at the same threshold would strand 3.70 % of all junction-bearing reads with no parent to inherit them. If the read total moves when you change --ec-mode, that is a defect — please report it.

⚠ The modes are off by default (fast = arda's historical behaviour), because whether the far class they collapse is badly-sequenced SHM or error is not settled: on a hypermutated IGH repertoire amplicon removes 178 clonotypes carrying 179 reads, 177 of them singletons, and on the matched naive library it removes zero. Depth: D segments, SHM, error correction.

Performance

Head-to-head, same input and same job

TRA amplicon, 100,000 reads, 8 threads.

tool config wall (s) CPU (s) peak RSS (MB)
arda 2.11.1 --two-pass --fast-segments --v-only-on-segment 5.35 12.73 631
MiXCR 4.7.0 align --preset rna-seq --species hsa 5.90 45.24 3,027

arda is 1.10× faster on wall clock at 3.6× less CPU and 4.8× less RSS — the wall figures are close, the resource figures are not, which is what matters when many samples share a node.

Bulk RNA-seq, 100,000 reads.

tool wall (s) CPU (s) peak RSS (MB) what it produced
arda 2.11.1 2.51 5.4 234 AIRR record per read, with junction
MiXCR 4.7.0 4.54 31.8 3,022 AIRR record per read, with junction
TRUST4 1.91 4.36 192 candidate read extraction only

⚠ TRUST4's stage here is candidate extraction, not a per-read AIRR record with a junction — it is doing less work, so the three rows are not like-for-like.

IGH RepSeq amplicon, 100,000 pairs, 32 threads. What the amplicon configuration is worth against the shipped one-pass default on hypermutated IGH:

dataset config wall (s) peak RSS (MB)
IGH_repertoire one-pass default 316.44 4,018
IGH_repertoire --two-pass --fast-segments --v-only-on-segment 76.25 1,479
IGH_naive one-pass default 305.32 3,736
IGH_naive --two-pass --fast-segments --v-only-on-segment 64.86 1,363

4.15× and 4.71×, at ~2.7× less memory.

vs TRUST4 on amplicon, same job, same staged input, same read cap (round 20, 32 threads on aldan3; every leg of a tier ran on the same input, so no ratio here is cross-job):

dataset reads arda amplicon wall (s) TRUST4 wall (s)
IGH_repertoire 100,000 201.05 615.04
IGH_naive 100,000 136.51 359.66
migec_exp1_TCR 500,000 316.25 423.96
migec_exp1_IGH 500,000 223.77 225.10

⚠ Wall clock only. The full-depth (hours-scale) head-to-head and the IgBLAST-truth accuracy leg scoring both tools on amplicon are scheduled for the next release — neither is measured yet, and neither is projected here.

Synthetic benchmarks vs IgBLAST

⚠ The two tables below are synthetic — generated human IGH sequences, not a real library — from scripts/bench_vs_igblast.py and scripts/bench_prefilter.py. They measure scaling shape, not head-to-head standing; use the tables above for that. 16 threads.

sequences arda wall arda rate speedup vs IgBLAST region concordance
10,000 5.5 s ~1.8k/s 4.4× 98.9%
50,000 16 s ~3.0k/s 7.3×
100,000 30 s ~3.3k/s 7.9×

Bulk RNA-seq is faster per read than amplicon, because mmseqs prefilters by k-mer matching — reads with no receptor k-mer are rejected before alignment. 150 nt reads, 16 threads:

receptor content throughput
100% (amplicon) ~5.7k reads/s
10% ~19k reads/s
1% (blood RNA-seq) ~25k reads/s

Memory

arda is CPU-bound; large FASTQ is streamed in bounded chunks (a background reader prefetches the next chunk while the current one is annotated), so mapping is flat at ~300–650 MB at any read depth. Peak RSS tracks repertoire richness, not reads: Stage 3 holds the clone set, so on a B-cell-rich tumour (28,444 clonotypes from 105 M reads) correct peaked at 2,071.7 MB, while a colder sample with more reads (139 M) peaked at 549 MB. Budget ~4 GB, and size a SLURM --mem from Stage 3, never Stage 1.

Accuracy

Recall on bulk RNA-seq — arda vs TRUST4 vs MiXCR

The three-way comparison, on the same 16 datasets where every tool ran, 5,273 real fragments, Wilson 95 % CIs. Best bold; ties bold together.

tool config recall precision (lower bound) false positives FP / 1M reads peak RSS
arda shipped defaults 0.986 [.982–.989] 0.889 [.881–.897] 70 21.9 254 MB
TRUST4 defaults 0.987 [.984–.990] 0.160 [.156–.164] 22,185 6,932.8 306 MB
MiXCR -OallowNoCDR3PartAlignments=true -OminSumScore=40 0.964 [.958–.969] 0.051 [.050–.052] 91,229 28,509.1 1,213 MB
MiXCR align --preset rna-seq as shipped 0.193 [.183–.204] 0.565 [.542–.588] 91 28.4 1,213 MB
arda --reconstruct (6 paired datasets) 0.995 0.905 14 11.7 249 MB

Recall is a statistical tie between arda and TRUST4 — a 6-fragment gap with overlapping CIs, so both are marked winners and neither should be quoted as "higher recall" than the other. Precision is not a tie: arda's lower bound (0.881) sits above every competitor's upper bound.

Benchmark MiXCR at its best config, not its default. align --preset rna-seq as shipped gives 0.193 recall; the two free options above take it to 0.964. Quoting the default alone is the mistake this project made and had to retract.

⚠ Precision here is a lower bound — the grey band 30 ≤ v_score < 70 is scored under neither metric. ⛔ And TRUST4's recall and FP are scored on its candidate extraction, a different (and much less filtered) stage than arda's post---min-score output; the two are not like-for-like on FP, which is why the FP column carries a per-1M normalisation rather than a bare ratio.

What explains the table is the J→C class — 22 % of real fragments on bulk:

tool V-covered reads (n = 4,117) J→C agreement (n = 1,156)
arda 0.9864 0.9844
TRUST4 0.9944 0.9611
MiXCR (recall config) 0.9990 0.8382
MiXCR (default) 0.1482 0.3538

On V-covered reads every tool is ≥ 0.986. arda's overall recall rests on the 345 J + C scaffolds in its reference, which took that class from 0.0606 to 0.9844 and overall recall from 0.78 to 0.986. ⚠ Reported as agreement, not recall: arda now ships C scaffolds, so the adjudicator is no longer independent of it there.

Gene calls on a targeted amplicon

Against an IgBLAST truth on a TRA amplicon, 100,000 reads:

metric arda 2.11.1 MiXCR 4.7.0
v_gene recall .9867 .9973
v_gene precision .9996 .9978
v_allele resolved .9868 n/a
j_gene recall .9892 .9904
j_gene precision .9953 .9995
junction precision, among emitted .99919 .99991

arda's V calls are the more precise of the two: it declines rather than guessing. MiXCR suffixes every allele *00, i.e. it makes no allele call at all, so v_allele has no comparator.

Score alleles as tie lists, not exact strings. IgBLAST and arda both return an ambiguous allele as a comma-joined set; scoring that as a miss is a scoring artifact, not an error. Across 25 datasets the median is v_allele_exact .8328 against v_allele_resolved .9763 — 14 points of the apparent gap is the scoring rule.

A V/J boundary disagreement inside the junction is not an error. V(D)J recombination is probabilistic: exonuclease chew-back and N/P-nucleotide addition mean the V-end / N-D-N / J-start partition is often not identifiable from sequence alone, so overlapping V/J/NDN assignments are acceptable and the ground truth is unknown. What is checkable, and what the table scores: the junction's outer bounds (Cys104 and [FW]118), the gene/allele calls, and whether a tool invents a junction it has no anchor for.

On ~7.3k real GenBank mRNA records spanning all five organisms and their loci (committed, gzipped test fixtures), region concordance with IgBLAST on productive records is 98–99.7% per organism, and junction_aa/cdr3_aa match IgBLAST ~99% while satisfying the AIRR invariants exactly. (GenBank also contains genomic/partial/non-productive entries that confuse both tools; those are excluded.)

Bulk RNA-seq mode

arda rnaseq is a recall-first pipeline for extracting the repertoire from bulk RNA-seq, where 1–5% of reads are receptor-derived:

arda map      --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --report run.json
arda assemble -i mapped.airr.tsv -o assembled.airr.tsv
arda correct  -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv

--extra-airr is what folds Stage 3 back in; without it the assembled reads are silently discarded. arda rnaseq / arda amplicon do all three in one call and wire it for you.

  • map streams paired FASTQ, keeps only reads mapping to a receptor scaffold, and writes them as AIRR. The reference includes J + C constant-region scaffolds, so a read spanning the J→C splice — which ends in the constant region and has no V to anchor — still maps and carries a c_call (the CH1 exon) plus a c_class isotype (IGHG/IGHM/IGHA … — the class, never the noise-prone subclass). In paired mode the isotype of a CDR3-bearing read is recovered from its constant-region mate. --reconstruct merges each overlapping mate pair into one fragment, resolving overlap mismatches by the higher-Phred base.
  • assemble reconstructs clonotypes whose CDR3 is too long for any single 100–150 bp read to span (V(DD)J ultralong, ~20–40 aa) by greedy overlap-extension anchored on Stage-1's per-read cdr3_start.
  • correct aggregates reads into clonotypes and collapses sequencing-error CDR3 variants. Abundance is the AIRR duplicate_count — every read that encompasses the junction, the true expression estimate — with consensus_count for distinct fragments.

arda igblast -i reads.fastq -o truth.airr.tsv runs IgBLAST across all loci as a gold-standard reference for benchmarking (see the arda-benchmark project).

Error correction: --error-rate is a per-library calibration

correct's error model is per-base with a length-scaled threshold (a mismatch over a longer junction is likelier an error) and is SHM-indel-tolerant. Its one knob is --error-rate, and the default (1e-3, ~Phred 30) is not universally safe:

On the MIGEC spike-in library (PRJNA239303), at the default --error-rate 1e-3 arda erases both published spike-in variants. That is a signal-to-noise limit, not a defect: on the paper's own metric computed over raw reads, V1/Err1 = 1.35 and V2/Err2 = 0.28 — the second variant is less abundant than the worst 2-substitution PCR error in the same library, so no abundance-based method, at any threshold, can separate them. That is precisely why UMI consensus exists; it moves V1/Err1 to 26–76 before any correction runs.

What to do about it:

arda correct -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv --error-rate 1e-5

1e-5 recovers both spike-in variants exactly. On an independent error cloud, 1e-4 kept both while still removing 72% of the real PCR errors. --error-rate has a physical reading — ~1e-3 for raw reads (the sequencer's Phred-30 substitution rate) and ~1e-5 for UMI-consensus input — so calibrate per library rather than trusting one default.

And it no longer has to cost precision. 1e-5 used to buy the variants at 3.5 points of purity on a monoclonal control (.99540 → .96034), because it also stops collapsing real PCR error. correct --min-junction-q gates on the Phred score of the one base that discriminates a clonotype from its putative parent — a measurement abundance does not have, and one that separates cleanly (the published spike-ins read median Q 34–35 there, the error cloud around them median Q 24):

arda map     --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --junction-quality
arda correct -i mapped.airr.tsv -o clones.tsv --error-rate 1e-5 --ec-mode accurate

Both variants kept, monoclonal purity back to .99530, spurious junctions 297 → 62, distinct error clonotypes 1,630 → 124. What it cannot do is rescue a variant below the template-error floor: RT and early-PCR errors happen before the UMI is attached, so consensus cannot remove them and they are high-Q by construction. Full write-up, including why binom/betabinom are not accurate: error correction.

Library

import arda

records = arda.annotate_sequences(
    ["GACGTGCAG...", ("clone7", "CAGGTG...")],  # strings or (id, seq) pairs
    seqtype="nt", organism="human",
)
# -> list of AIRR record dicts: v_call, d_call/d2_call, j_call, c_call/c_class,
#    fwr1..fwr4, cdr1..cdr3, *_start/*_end (1-based closed), *_aa, junction(_aa),
#    np1/np2/np3, d_support/d2_support, {v,j,c,d}_cigar, v_mutations/j_mutations,
#    sequence_alignment, germline_alignment, productive, ...
# The TSV is a spec-valid AIRR Rearrangement file (passes airr.schema validation).

Records with no read behind them

A VDJdb row is a CDR3 amino acid, a V call and a J call. There is nothing to align, but the germlines still template a known run of residues into each end of the junction:

from arda.cdr3fix import markup_cdr3
from arda.annotate.dmap import map_d_junction
from arda.dpost import posterior_d

mk = markup_cdr3("CAIRDDKII", "TRAV12-3*01", "TRAJ30*01", "HomoSapiens")
mk.cdr3_repaired            # 'CAIRDDKIIF'  -- the Phe118 anchor restored
[str(e) for e in mk.errors] # ["J del@8 missing 'F' d=0"]
mk.good                     # True: both sides repaired, both anchors present

junction_nt = "TGTGCTCTTGGGCCCCGGCCTTCCTACAGCGAGGAGTTGGGGGATACCCATCGGGCCGATAAACTCATCTTT"
map_d_junction(junction_nt, "TRDV1*01", "TRDJ1*01", "human").d2_call      # 'TRDD3*01' (tandem D-D)
posterior_d("CASSPLGQAYEQYF", "TRBV5-1*01", "TRBJ2-7*01", "human").d_call  # 'TRBD1'

Coordinates here are junction space — Cys104 through Phe/Trp118, both anchors included. That is what VDJdb's cdr3 column holds, and it is not arda's cdr3 field, which excludes both. Conflating them silently corrupts every coordinate.

Repair is conservative: only edits adjacent to a conserved anchor are applied, everything deeper is reported and left alone, and a repair is refused outright unless the result opens with Cys104 and closes with Phe/Trp118.

Annotating bare germline segments

There is no coverage filter, so a V-only or J-only query maps to its scaffold and only the regions inside the query's coverage are returned — a bare V yields fwr1..fwr3, a bare J yields fwr4:

from arda.annotate.mapper import annotate_records

recs = annotate_records(
    [("TRBV9*01", v_germline_nt), ("TRBJ2-7*01", j_germline_nt)],
    organism="human", seqtype="nt", strand="forward", map_d=False,
)

(mirpy uses exactly this to bake per-allele FR/CDR subsequences into its gene library; see tests/synthetic/test_germline_segments.py. arda export-ref is the CLI equivalent.)

How it works

  1. Reference build (arda.refbuild, offline): download IMGT/V-QUEST germlines → enumerate deduplicated in-frame V×J scaffolds (D only affects CDR3 interior, so it isn't enumerated) plus J + C constant-region scaffolds (the CH1 exon spliced onto each J, so J→C reads have somewhere to land) → annotate with igblastn -outfmt 19 → translate → write database/vdj/<organism>/{alleles.fasta, alleles.aa.fasta, markup.tsv, markup.aa.tsv, combinations.tsv, d_germlines.fasta, cdr3_anchors.tsv, d_prior.tsv, build.log}.

  2. Runtime (arda.annotate): MMseqs2 search query→scaffolds → best hit → C++ transfer_regions projects scaffold region coordinates onto the query (handling indels, truncation, mid-codon alignment starts, reverse strand) → for VDJ loci a gapless C++ local alignment of the CDR3 interior against the D germlines adds d_call/d2_call + np*; a hit on a J + C scaffold adds c_call/c_class → AIRR TSV. Ambiguous D and C calls are comma-joined allele lists, as V/J already are. Out-of-frame junctions are reported with an N-bridge (_) so FR4 still reads.

    The V..J interior is bounded by the per-allele junction anchors in cdr3_anchors.tsv, not by the scaffold projection — a scaffold has a 9 nt N-pad where a read has a 20–40 nt N-D-N region, so the projection collapses the very window the D lives in. A junction is emitted only when the read actually reaches its Cys104 anchor. The D call is accepted on a Karlin–Altschul E-value (d_support, re-thresholdable with --d-max-evalue) rather than a per-locus score floor, and is constrained by germline geometry before the statistics: /OR orphons sit outside the locus and cannot rearrange at all; TRBD2 lies 3′ of the entire TRBJ1 cluster, so a TRBJ1 rearrangement can never be assigned TRBD2; and a tandem D-D must run in genomic 5′→3′ order, since deletional joining cannot produce any other. D mapping also runs on --seqtype aa, against each D germline's three translated frames.

  3. Bare records (arda.cdr3fix, arda.dpost): a VDJdb-style row — CDR3 amino acid, V, J, species, and no read — is marked up against the same anchors (arda markup), its errors located and conservatively repaired, and optionally given a D gene inferred from the junction length (--d-posterior).

Fast sequence primitives (translate, detect_coding_frame, reverse_complement, back_translate) live in the C++ extension and are re-exported from arda.refbuild.translate — mirpy-API-compatible, so mirpy can import arda and reuse them.

The reference ships with precompiled MMseqs2 indexes (database/vdj/<organism>/mmseqs/), used automatically when the local MMseqs2 version matches; otherwise arda transparently rebuilds a private cache on first run (arda build-index regenerates the shipped DBs). segments.fasta — the collapsed per-allele reference the two-pass path uses — is generated, not shipped, and is built on demand when missing.

Pipeline integration

arda rnaseq / arda amplicon write <prefix>.clones.tsv (AIRR clonotypes), <prefix>.airr.tsv (mapped reads), <prefix>.assembled.airr.tsv and <prefix>.arda.json (run report). Because it is a plain CLI over named files, it drops into any workflow engine with no glue code.

A ready-to-use Nextflow module lives in integrations/nextflow/arda/: copy it to modules/local/arda/, feed it the trimmed per-sample FASTQ channel the aligners already use, and it publishes per-sample clonotype tables to ${params.outdir}/arda/. It ships a conda environment.yml (works with -profile conda) and a Dockerfile, and emits a versions.yml. See its README and the pipeline-integration guide.

The module exposes the regime and the denoising framework as params, so nothing needs task.ext.args surgery:

params {
    regime             = 'amplicon'   // or 'bulk' (default); per-sample via meta.regime
    arda_ec_mode       = 'amplicon'   // fast (default) | accurate | amplicon | rnaseq
    arda_clonotype_key = 'junction'   // full (default) | junction
    arda_mmseqs        = '/opt/conda/bin/mmseqs'
}

It validates both against their allowed sets and warns when arda_ec_mode and regime disagree (e.g. the amplicon preset on a bulk library), because those presets are tuned to opposite clonotype-size distributions and picking the wrong one is a real cost rather than a no-op.

On a cluster, arda slurm writes a submit.sh chaining split → sbatch --array → merge with an afterok dependency, and a sharded run is byte-identical to a single-node one. ⛔ Shard Stage 1 only: error correction compares a clonotype against its neighbours by abundance, so running it per shard asks the question against a fraction of the evidence. See the cluster guide.

Roadmap / TODO

See ROADMAP.md for the full list. Done: the V·J reference build across 5 organisms, MMseqs2 mapping with C++ markup transfer, all-loci querying, streaming I/O, D-segment mapping incl. D-D fusions (nt and aa input, E-value gated, genomic-order constrained), constant-region J + C scaffolds (c_call/c_class isotype), bulk RNA-seq mode with long-CDR3 contig assembly and coverage-based expression, junction markup + repair on bare records, multi-node (SLURM) sharding, the segment-based fast paths (--two-pass, --fast-segments, --v-only-on-segment, --prefilter, --indel-rescue), per-segment SHM in germline coordinates (v_mutations/j_mutations), quality-gated error correction (--junction-quality, --min-junction-q, --ec-mode) and arda export-ref.

Next: full-depth clonotype benchmarking; a segment-native per-read path that removes MMseqs2 from the amplicon hot loop; and an arda.hmm semi-Markov model of V→N→D→N→J that would subsume the E-value gate, the genomic-order constraint and the D posterior into one forward–backward pass.

Development

pip install -e .                                      # rebuilds the C++ ext on import
python -m pytest tests/unit tests/synthetic -q        # fast suite (needs mmseqs)
python -m pytest tests/realworld -q                   # vs IgBLAST, on committed fixtures — offline
env RUN_BENCHMARK=1 python -m pytest tests/benchmark -s   # timing/memory/scaling

Optional extras gate optional suites: .[groundtruth] (olga) for the generative ground-truth tests that keep arda.cdr3fix honest, .[test] for airr schema validation. Without them those tests skip, so pip install -e '.[test]' before reading a green suite as full coverage.

Layout: src/arda/{refbuild,annotate}, C++ in src/_markup/markup.cpp and src/_segmap/segmap.cpp, references in database/, downloads in gitignored bin/ + data/.

Release files for arda-mapper 2.18.1

For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.

Source distribution (sdist)

Source distribution for arda-mapper 2.18.1
File Size Uploaded
arda_mapper-2.18.1.tar.gz 9.6 MB Details

Built distributions (wheels)

Table of built distributions (wheels) for arda-mapper 2.18.1
File
arda_mapper-2.18.1-cp313-cp313-win_amd64.whl CPython 3.13 CPython 3.13 Windows x86-64 Details
arda_mapper-2.18.1-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.13 CPython 3.13 Linux glibc 2.17+ x86-64 Details
arda_mapper-2.18.1-cp313-cp313-macosx_11_0_arm64.whl CPython 3.13 CPython 3.13 macOS 11.0+ ARM64 Details
arda_mapper-2.18.1-cp312-cp312-win_amd64.whl CPython 3.12 CPython 3.12 Windows x86-64 Details
arda_mapper-2.18.1-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.12 CPython 3.12 Linux glibc 2.17+ x86-64 Details
arda_mapper-2.18.1-cp312-cp312-macosx_11_0_arm64.whl CPython 3.12 CPython 3.12 macOS 11.0+ ARM64 Details
arda_mapper-2.18.1-cp311-cp311-win_amd64.whl CPython 3.11 CPython 3.11 Windows x86-64 Details
arda_mapper-2.18.1-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.11 CPython 3.11 Linux glibc 2.17+ x86-64 Details
arda_mapper-2.18.1-cp311-cp311-macosx_11_0_arm64.whl CPython 3.11 CPython 3.11 macOS 11.0+ ARM64 Details
arda_mapper-2.18.1-cp310-cp310-win_amd64.whl CPython 3.10 CPython 3.10 Windows x86-64 Details
arda_mapper-2.18.1-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl CPython 3.10 CPython 3.10 Linux glibc 2.17+ x86-64 Details
arda_mapper-2.18.1-cp310-cp310-macosx_11_0_arm64.whl CPython 3.10 CPython 3.10 macOS 11.0+ ARM64 Details

Total release size: 17.7 MB

Release files / arda_mapper-2.18.1.tar.gz

Download URL arda_mapper-2.18.1.tar.gz
Size 9.6 MB
Tags Source
SHA-256 checksum
How to use checksums
fa569faba9e2ecd42121b6db48fc76f3aa59c23e0a8937f65e5a3a783f16994d
BLAKE2b-256 checksum
How to use checksums
1f15730aed7c385d5a29034d85a5728873b30b3197e8b22ecb07bb22a4bb5107
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp313-cp313-win_amd64.whl

Download URL arda_mapper-2.18.1-cp313-cp313-win_amd64.whl
Size 682.4 kB
Tags CPython 3.13 Windows x86-64
SHA-256 checksum
How to use checksums
bee1918b154fea5d199065dbf8cbbead3b98020334e2270006718bed920d9412
BLAKE2b-256 checksum
How to use checksums
867d4563c81f50ca8501be61d9099cb5c44a109bffae6fb8c0b28d84f30c91e2
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL arda_mapper-2.18.1-cp313-cp313-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 747.7 kB
Tags CPython 3.13 Linux glibc 2.17+ x86-64
SHA-256 checksum
How to use checksums
236dc4ca9cb8148af139fbcd79636a8c1d3c5681269aaf2fd8ac31359919d5de
BLAKE2b-256 checksum
How to use checksums
f85c8644144cf9f7f48fd1cc1c6a242607299271f87d85fab9b48ec6b8242f1f
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp313-cp313-macosx_11_0_arm64.whl

Download URL arda_mapper-2.18.1-cp313-cp313-macosx_11_0_arm64.whl
Size 596.8 kB
Tags CPython 3.13 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
dd9fe34a1b8d0bed901dc00aa797eef9ba21d675a4501b8e36ca66f94f2bf06a
BLAKE2b-256 checksum
How to use checksums
3a0597b4d619cababc08c9201e660f80c84b8e0252dda2d5c1f5556c486f076f
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp312-cp312-win_amd64.whl

Download URL arda_mapper-2.18.1-cp312-cp312-win_amd64.whl
Size 682.3 kB
Tags CPython 3.12 Windows x86-64
SHA-256 checksum
How to use checksums
2c21613fdbe3efa264a0e1929bc36e9d71b6903f1639822e1e8289b42aee4be4
BLAKE2b-256 checksum
How to use checksums
e6ba96f0fee145b21b62c9c6116d02bac8d2ff1564863f36f54024a9ae249a19
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL arda_mapper-2.18.1-cp312-cp312-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 747.6 kB
Tags CPython 3.12 Linux glibc 2.17+ x86-64
SHA-256 checksum
How to use checksums
9dcba68c727405165a48d47b4be78eb3436ffb78535201003930ddd72d82e850
BLAKE2b-256 checksum
How to use checksums
0ff430f6784446d7120d2a007422b03749843a29bea405f72278154c28a8c22e
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp312-cp312-macosx_11_0_arm64.whl

Download URL arda_mapper-2.18.1-cp312-cp312-macosx_11_0_arm64.whl
Size 596.7 kB
Tags CPython 3.12 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
ff0c3099199630348dc9f68ec2cdca7f7463255d4eff6aa171bc38691f0f2fc1
BLAKE2b-256 checksum
How to use checksums
2b9320cb6025e71a21694b8f5f49f6b83fa18c9ceb4ea2a378ccdce1330c2290
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp311-cp311-win_amd64.whl

Download URL arda_mapper-2.18.1-cp311-cp311-win_amd64.whl
Size 675.6 kB
Tags CPython 3.11 Windows x86-64
SHA-256 checksum
How to use checksums
64bc7dda33287386628a7d0d9f38d5cf3e1b1760dd1707696b90d10145856dfc
BLAKE2b-256 checksum
How to use checksums
c89df533c9b94014b8c2329ea760892986efb03c94b497b845926bb9711bfa10
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL arda_mapper-2.18.1-cp311-cp311-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 753.1 kB
Tags CPython 3.11 Linux glibc 2.17+ x86-64
SHA-256 checksum
How to use checksums
a2ca320735dd8d3a8450c0ff57980c9f297c40defca95fa384e69149aebf4ef9
BLAKE2b-256 checksum
How to use checksums
9eea96467871a28b6b9f66277ad5b3609af4b1ff2aee22faca55b34b47d58a8c
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp311-cp311-macosx_11_0_arm64.whl

Download URL arda_mapper-2.18.1-cp311-cp311-macosx_11_0_arm64.whl
Size 595.6 kB
Tags CPython 3.11 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
729c3c8bdfde6b18aecafc93b739b901ffbea762f142175256ad3498b5cfff61
BLAKE2b-256 checksum
How to use checksums
dbb2f48d592f9724c3ce34f7504cdb010339f7898ca499cb41dc5142be92929d
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp310-cp310-win_amd64.whl

Download URL arda_mapper-2.18.1-cp310-cp310-win_amd64.whl
Size 671.7 kB
Tags CPython 3.10 Windows x86-64
SHA-256 checksum
How to use checksums
1a53b36e4188f713e2b2e6e86a913092c838eba722ed622e155ac7f47d0c266b
BLAKE2b-256 checksum
How to use checksums
691a78fddc11bc22ac149e6026d45c4e54b5c3e648afd034208965b465879ad4
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl

Download URL arda_mapper-2.18.1-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl
Size 746.9 kB
Tags CPython 3.10 Linux glibc 2.17+ x86-64
SHA-256 checksum
How to use checksums
ae453343e5eac002ddff08ef34c6fbf88a6e184631aeddfced1b729d58926f3a
BLAKE2b-256 checksum
How to use checksums
27491f189d5601e44f1aa27d1dd32983fb0c60a3642a3ef99534b1f4f79d60c3
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log

Release files / arda_mapper-2.18.1-cp310-cp310-macosx_11_0_arm64.whl

Download URL arda_mapper-2.18.1-cp310-cp310-macosx_11_0_arm64.whl
Size 591.1 kB
Tags CPython 3.10 macOS 11.0+ ARM64
SHA-256 checksum
How to use checksums
507bafbdc7308df96fbb2399e667f97a10c9505272e52dc708ffc21788b1612a
BLAKE2b-256 checksum
How to use checksums
dd438b999a95fc93d6b213407b49e22fd3e2ecc1e347fc8a6ac6ce40c1dd277d
Upload date
Uploaded using Trusted Publishing?
What is trusted publishing?
Yes
Uploaded via twine/7.0.0 CPython/3.13.14

Provenance

Provenance describes where a file came from. On PyPI, provenance is shared via attestations, which provide a verifiable record of the build or publishing details. View details, limitations and caveats.

PyPI Publish Attestation

PyPI verified that this artifact, at this checksum, originated from the publisher listed below.

Signed by GitHub Actions, verified by PyPI on Aug 11, 2026.

Transparency log
Anthropic, PBC Visionary sponsor Bloomberg Visionary sponsor Hudson River Trading Visionary sponsor Meta Visionary sponsor NVIDIA Visionary sponsor Microsoft Sustainability sponsor Depot Continuous Integration AWS Cloud computing and Security Sponsor Datadog Monitoring Fastly CDN Google Download Analytics Sentry Error logging StatusPage Status page