A Python utility library to estimate, compare, and reweight RNA energetics across many secondary structure algorithms.
Project description
arnie
Python API to compute RNA energetics and do structure prediction across multiple secondary structure packages.
Currently supported:
-
Vienna [1] [https://www.tbi.univie.ac.at/RNA/#download]
-
NUPACK [2] [http://www.nupack.org/downloads]
-
RNAstructure [3] [https://rna.urmc.rochester.edu/RNAstructure.html]
-
RNAsoft [4] [http://www.rnasoft.ca/download.html]
-
CONTRAfold [5] [http://contra.stanford.edu/contrafold/]
-
EternaFold [6] [http://https://eternagame.org/about/software]
(c) 2020 Leland Stanford Jr University
Authors: Hannah Wayment-Steele
Organization:
notebooks: example jupyter notebooks with usage.
scripts: scripts for processing sequences in batch.
parameter_files: dir of various parameter files for packages, put here out of convenience.
test: unit tests (still in work)
mea: code for computing Maximum Expected Accuracy structures.
RNAGraph: DEPRECATED, see https://github.com/DasLab/RiboGraphViz/ for current version of the code. Code to process and visualize secondary structures as graph objects.
Setup:
- To use Arnie, you will create a file that contains the paths to the software packages that Arnie is wrapping. See
docs/setup_doc.mdfor installation instructions and troubleshooting tips, as well as instructions for setting up the arnie file.
Quickstart: an example file is provided in example_arnie_file.txt.
- Create a variable in your .bashrc:
export ARNIEFILE="/path/to/arnie/<my_file.txt>"
- Add Arnie location to your python path in your .bashrc, i.e.
export PYTHONPATH=$PYTHONPATH:/path/to/arnie
Usage:
See notebooks/start_here.ipynb for example syntax. In brief, comparing across packages is simple. For computing base pairing probability matrices:
from arnie.bpps import bpps
bpps_dict = {}
my_sequence = 'CGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCG'
for pkg in ['vienna','nupack','RNAstructure','contrafold','RNAsoft']:
bpps_dict[pkg] = bpps(my_sequence, package=pkg)
Can also analyze as average base pairing per nucleotide:
References
- Lorenz, R. et al. ViennaRNA Package 2.0. Algorithms Mol Biol 6, 26 (2011).
- Zadeh, J.N. et al. NUPACK: Analysis and design of nucleic acid systems. J Comput Chem 32, 170-173 (2011).
- Reuter, J.S. & Mathews, D.H. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 11, 129 (2010).
- Andronescu, M., Condon, A., Hoos, H.H., Mathews, D.H. & Murphy, K.P. in RNA, Vol. 16 2304-2318 (2010).
- Do, C.B., Woods, D.A. & Batzoglou, S. CONTRAfold: RNA secondary structure prediction without physics-based models. Bioinformatics 22, e90-98 (2006).
- Wayment-Steele, H.K., Kladwang, W., Eterna Participants, R. Das, Biorxiv (2020).
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file arnie-0.1.2.tar.gz.
File metadata
- Download URL: arnie-0.1.2.tar.gz
- Upload date:
- Size: 41.0 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.2 CPython/3.11.4
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
faf038d817db358803c21e32ff80624c7ca0c8ffe961ef71c12b3ad770d04198
|
|
| MD5 |
e22e7ce2c1871d5c4528521d464b6a9a
|
|
| BLAKE2b-256 |
99729d0ba2e438ee398e4145cd3dfa84eaffe160b1089e69ff6f98f608acaa14
|
File details
Details for the file arnie-0.1.2-py3-none-any.whl.
File metadata
- Download URL: arnie-0.1.2-py3-none-any.whl
- Upload date:
- Size: 38.8 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/4.0.2 CPython/3.11.4
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
3dbcb2ae42acd9cd4412e991e41976c06d6a917e1f284d586fa5451d5e6762c6
|
|
| MD5 |
9a0833fa02271f4d88d304a1a8b30d5c
|
|
| BLAKE2b-256 |
633851dc610eff602eda68f6001187c225e71b0ae241e623c86c826436be7acc
|