arnie 0.1.5

A Python utility library to estimate, compare, and reweight RNA energetics across many secondary structure algorithms.

arnie

Python API to compute RNA energetics and do structure prediction across multiple secondary structure packages.

Currently supported:

• Vienna [1] [https://www.tbi.univie.ac.at/RNA/#download]

• NUPACK [2] [http://www.nupack.org/downloads]

• RNAstructure [3] [https://rna.urmc.rochester.edu/RNAstructure.html]

• RNAsoft [4] [http://www.rnasoft.ca/download.html]

• CONTRAfold [5] [http://contra.stanford.edu/contrafold/]

• EternaFold [6] [http://https://eternagame.org/about/software]

(c) 2020 Leland Stanford Jr University

Authors: Hannah Wayment-Steele

Organization:

notebooks: example jupyter notebooks with usage.

scripts: scripts for processing sequences in batch.

parameter_files: dir of various parameter files for packages, put here out of convenience.

test: unit tests (still in work)

mea: code for computing Maximum Expected Accuracy structures.

RNAGraph: DEPRECATED, see https://github.com/DasLab/RiboGraphViz/ for current version of the code. Code to process and visualize secondary structures as graph objects.

Setup:

1. To use Arnie, you will create a file that contains the paths to the software packages that Arnie is wrapping. See docs/setup_doc.md for installation instructions and troubleshooting tips, as well as instructions for setting up the arnie file.

Quickstart: an example file is provided in example_arnie_file.txt.

2. Create a variable in your .bashrc:

export ARNIEFILE="/path/to/arnie/<my_file.txt>"

3. Add Arnie location to your python path in your .bashrc, i.e.

export PYTHONPATH=$PYTHONPATH:/path/to/arnie

Usage:

See notebooks/start_here.ipynb for example syntax. In brief, comparing across packages is simple. For computing base pairing probability matrices:

from arnie.bpps import bpps

bpps_dict = {}
my_sequence = 'CGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCG'

for pkg in ['vienna','nupack','RNAstructure','contrafold','RNAsoft']:
    bpps_dict[pkg] = bpps(my_sequence, package=pkg)

Can also analyze as average base pairing per nucleotide:

References

1. Lorenz, R. et al. ViennaRNA Package 2.0. Algorithms Mol Biol 6, 26 (2011).
2. Zadeh, J.N. et al. NUPACK: Analysis and design of nucleic acid systems. J Comput Chem 32, 170-173 (2011).
3. Reuter, J.S. & Mathews, D.H. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 11, 129 (2010).
4. Andronescu, M., Condon, A., Hoos, H.H., Mathews, D.H. & Murphy, K.P. in RNA, Vol. 16 2304-2318 (2010).
5. Do, C.B., Woods, D.A. & Batzoglou, S. CONTRAfold: RNA secondary structure prediction without physics-based models. Bioinformatics 22, e90-98 (2006).
6. Wayment-Steele, H.K., Kladwang, W., Eterna Participants, R. Das, Biorxiv (2020).