Tools to design and analyse CRISPRi experiments
Project description
CRISPRbact
Tools to design and analyse CRISPRi experiments in bacteria.
CRISPRbact is a Python library and command-line tool for designing CRISPRi (CRISPR interference) experiments with the Streptococcus pyogenes dCas9 protein in bacteria.
Features
- On-target activity prediction — predicts how effectively each guide RNA will block gene expression, using a linear model trained on ~92,000 guides in E. coli
- Genome-wide library design — designs optimized CRISPRi libraries for any bacterial genome, selecting the best guides per gene while avoiding off-targets and toxic seed sequences
- Library mapping — evaluates an existing guide library against a new genome to assess coverage and predict activity
- Add-on library design — supplements an existing library (e.g. a core-genome library) with strain-specific guides to achieve full gene coverage
- Core-genome library design — designs guide libraries targeting genes conserved across multiple strains, enabling cross-strain CRISPRi screens
Installation
pip install crisprbact
Quick example
from crisprbact import on_target_predict
guides = on_target_predict("ACCACTGGCGTGCGCGTTACTCATCAGATGCTGTTCAATACCGATCAGGTTATCGAAGTGTTTGTGATTGTTTGCCGCGCGCGTGGCGAAGGCCCGTGATGAAGGAAAAGTTTTGCGCTATGTTGGCAATATTGATGAAG")
for g in guides:
print(g["guide"], round(g["pred"], 2))
Documentation
Full documentation (guides, API reference, output formats): https://dbikard.pages.pasteur.fr/crisprbact/
References
- Calvo-Villamañán, Wong Ng et al., "On-target activity predictions enable improved CRISPR–dCas9 screens in bacteria", Nucleic Acids Research, 2020, 48(11):e64 (doi:10.1093/nar/gkaa294)
- Rousset F et al., "The impact of genetic diversity on gene essentiality within the Escherichia coli species." Nature Microbiology 6, 301–312 (2021) (doi:10.1038/s41564-020-00839-y)
- Rostain et al., "Cas9 off-target bindings as a source of far-reaching transcriptional noise", Nucleic Acids Research, 2023 (doi:10.1093/nar/gkad170)
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file crisprbact-1.4.1.tar.gz.
File metadata
- Download URL: crisprbact-1.4.1.tar.gz
- Upload date:
- Size: 271.7 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: uv/0.11.23 {"installer":{"name":"uv","version":"0.11.23","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Debian GNU/Linux","version":"13","id":"trixie","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
ccdd268519cb2e5e29caa96e03233583ccff49e07c299b9600d87cd4bd6b5a7e
|
|
| MD5 |
f6cc0855597a1627c23b5e077d71bb95
|
|
| BLAKE2b-256 |
c49f3458b6c4b87cd837a66fca13a8a18d5c1b043c558a106f4f4360bbe8dfe4
|
File details
Details for the file crisprbact-1.4.1-py3-none-any.whl.
File metadata
- Download URL: crisprbact-1.4.1-py3-none-any.whl
- Upload date:
- Size: 79.0 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: uv/0.11.23 {"installer":{"name":"uv","version":"0.11.23","subcommand":["publish"]},"python":null,"implementation":{"name":null,"version":null},"distro":{"name":"Debian GNU/Linux","version":"13","id":"trixie","libc":null},"system":{"name":null,"release":null},"cpu":null,"openssl_version":null,"setuptools_version":null,"rustc_version":null,"ci":true}
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
1d5fd9e76a1a233e032b9180000723ab7b5c0fa03cf5c35f985878b2bf49accf
|
|
| MD5 |
7d411856f29abea45a1fe6da58545bc8
|
|
| BLAKE2b-256 |
36ac609247d9be0348ec897616b0f929c82703fca9edc54d9331887531bcf1bc
|