dynordg 0.4.4

Simulate and render the flux of Ribosomes through Ribosomal Phase Space

DYNORDG

Dynamic Ribosome Decision Graphs (RDGs) for simulating and visualizing ribosome flux along transcripts.

Overview

A Ribosome Decision Graph (RDG) models the possible paths a ribosome can take along an mRNA transcript.

Dynamic RDGs extend this by:

• Representing ribosome flux using edge thickness
• Implicitly encoding overlapping translons via flow rather than explicit separation
• Modeling ribosomal phase states based on downstream potential

This package provides tools to:

• Build RDGs from transcript sequences, or from user defined phase transistions
• Simulate ribosome movement
• Render dynamic flux graphs

Installation

pip install dynordg

Quick Start

from dynordg import quick_plot

# Creat Render Object
plot = quick_plot("AUGGCCAUGGCGCCCAGAACUGGGUAA")

# Render
plot.show()

Example Output

Below is example dynamic RDG (if not a realistic one):