Simulate and render the flux of Ribosomes through Ribosomal Phase Space
Project description
DYNORDG
Dynamic Ribosome Decision Graphs (RDGs) for simulating and visualizing ribosome flux along transcripts.
Overview
A Ribosome Decision Graph (RDG) models the possible paths a ribosome can take along an mRNA transcript.
Dynamic RDGs extend this by:
- Representing ribosome flux using edge thickness
- Implicitly encoding overlapping translons via flow rather than explicit separation
- Modeling ribosomal phase states based on downstream potential
This package provides tools to:
- Build RDGs from transcript sequences, or from user defined phase transistions
- Simulate ribosome movement
- Render dynamic flux graphs
Installation
pip install dynordg
Quick Start
from dynordg import Transcript, RiboGraphFlux, RiboGraphVis
# Create transcript
t = Transcript("AUGGCCAUGGCGCCCAGAACUGGGUAA")
# Automatically detect start/stop events
t.auto_stop_starts()
# Build flux graph
graph = RiboGraphFlux(t.transition_map())
# Create render object
plot = RiboGraphVis(graph)
# Render
plot.show()
Example Output
Below is example dynamic RDG (if not a realistic one):
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file dynordg-0.3.0.tar.gz.
File metadata
- Download URL: dynordg-0.3.0.tar.gz
- Upload date:
- Size: 428.1 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.13.5
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
c5bb5fbca3d9df5e3ae6c81ca739077ce22d68c4fdb3909c8f87f7a48ca20fe2
|
|
| MD5 |
090b553925172e3aba981b0caec9e9e9
|
|
| BLAKE2b-256 |
e8e48baee0cf7621b3349b5cd0715d278769bb239488dd37f9abec45fe47acbf
|
File details
Details for the file dynordg-0.3.0-py3-none-any.whl.
File metadata
- Download URL: dynordg-0.3.0-py3-none-any.whl
- Upload date:
- Size: 430.8 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.2.0 CPython/3.13.5
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
c3d50d33d64047d4b165594bd93d21edea2e780088a868f9c2956429686a626a
|
|
| MD5 |
9ba328a5464cc7b7a0ec58001658ffbd
|
|
| BLAKE2b-256 |
d0ef72dc1236cea5e24ef537e861631a33c82c6b7f42f6b3d6aa98aa8f465e66
|