This is a pre-production deployment of Warehouse, however changes made here WILL affect the production instance of PyPI.
Latest Version Dependencies status unknown Test status unknown Test coverage unknown
Project Description

fuzzysearch is useful for finding approximate subsequence matches


Just install using pip:

$ pip install fuzzysearch


  • Fuzzy sub-sequence search: Find parts of a sequence which match a given sub-sequence up to a given maximum Levenshtein distance.
  • Set individual limits for the number of substitutions, insertions and/or deletions allowed for a near-match.
  • Includes optimized implementations for specific use-cases, e.g. only allowing substitutions in near-matches.

Simple Example

You can usually just use the find_near_matches() utility function, which chooses a suitable fuzzy search implementation according to the given parameters:

>>> from fuzzysearch import find_near_matches
>>> find_near_matches('PATTERN', 'aaaPATERNaaa', max_l_dist=1)
[Match(start=3, end=9, dist=1)]

Advanced Example

If needed you can choose a specific search implementation, such as find_near_matches_with_ngrams():

>>> sequence = '''\
>>> subsequence = 'TGCACTGTAGGGATAACAAT' #distance 1
>>> max_distance = 2

>>> from fuzzysearch import find_near_matches_with_ngrams
>>> find_near_matches_with_ngrams(subsequence, sequence, max_distance)
[Match(start=3, end=24, dist=1)]


0.3.0 (2015-02-12)

  • Added C extensions for several search functions as well as internal functions
  • Use C extensions if available, or pure-Python implementations otherwise
  • attempts to build C extensions, but installs without if build fails
  • Added --noexts option to avoid trying to build the C extensions
  • Greatly improved testing and coverage

0.2.2 (2014-03-27)

  • Added support for searching through BioPython Seq objects
  • Added specialized search function allowing only subsitutions and insertions
  • Fixed several bugs

0.2.1 (2014-03-14)

  • Fixed major match grouping bug

0.2.0 (2013-03-13)

  • New utility function find_near_matches() for easier use
  • Additional documentation

0.1.0 (2013-11-12)

  • Two working implementations
  • Extensive test suite; all tests passing
  • Full support for Python 2.6-2.7 and 3.1-3.3
  • Bumped status from Pre-Alpha to Alpha

0.0.1 (2013-11-01)

  • First release on PyPI.
Release History

Release History


This version

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More


History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More


History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More


History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More


History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

Download Files

Download Files

TODO: Brief introduction on what you do with files - including link to relevant help section.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
fuzzysearch-0.3.0-cp26-none-macosx_10_8_x86_64.whl (54.4 kB) Copy SHA256 Checksum SHA256 2.6 Wheel Feb 14, 2015
fuzzysearch-0.3.0-cp27-none-macosx_10_8_x86_64.whl (54.4 kB) Copy SHA256 Checksum SHA256 2.7 Wheel Feb 14, 2015
fuzzysearch-0.3.0-cp32-cp32m-macosx_10_8_x86_64.whl (54.8 kB) Copy SHA256 Checksum SHA256 3.2 Wheel Feb 14, 2015
fuzzysearch-0.3.0-cp33-cp33m-macosx_10_8_x86_64.whl (54.9 kB) Copy SHA256 Checksum SHA256 3.3 Wheel Feb 14, 2015
fuzzysearch-0.3.0-cp34-cp34m-macosx_10_8_x86_64.whl (55.0 kB) Copy SHA256 Checksum SHA256 3.4 Wheel Feb 14, 2015
fuzzysearch-0.3.0.tar.gz (52.7 kB) Copy SHA256 Checksum SHA256 Source Feb 12, 2015

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting