fuzzysearch
Easy fuzzy search that just works, fast!
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1)]
Approximate sub-string searches
A single, simple function to use
Chooses the fastest available search mechanism based on the given input
Uses the Levenshtein Distance metric with configurable parameters
Separately configure the max. allowed distance, substitutions, deletions and insertions
Advanced algorithms with optional C and Cython optimizations
Extensively tested
Free software: MIT license
For more info, see the documentation.
Installation
$ pip install fuzzysearch
This will work even if installing the C and Cython extensions fails, using pure-Python fallbacks.
Usage
Just call find_near_matches() with the sub-sequence you’re looking for, the sequence to search, and the matching parameters:
>>> from fuzzysearch import find_near_matches
# search for 'PATTERN' with a maximum Levenshtein Distance of 1
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1)]
>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' # distance = 1
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1)]
Matching Criteria
The search function supports four possible match criteria, which may be supplied in any combination:
maximum Levenshtein distance (max_l_dist)
maximum # of subsitutions
maximum # of deletions (“delete” = skip a character in the sub-sequence)
maximum # of insertions (“insert” = skip a character in the sequence)
Not supplying a criterion means that there is no limit for it. For this reason, one must always supply max_l_dist and/or all other criteria.
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1)]
# this will not match since max-deletions is set to zero
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1, max_deletions=0)
[]
# note that a deletion + insertion may be combined to match a substution
>>> find_near_matches('PATTERN', '---PAT-ERN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=1)] # the Levenshtein distance is still 1
# ... but deletion + insertion may also match other, non-substitution differences
>>> find_near_matches('PATTERN', '---PATERRN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=2)]
History
0.6.1 (2018-12-08)
Fixed some C compiler warnings for the C and Cython modules
0.6.0 (2018-12-07)
Dropped support for Python versions 2.6, 3.2 and 3.3
Added support and testing for Python 3.7
Optimized the n-grams Levenshtein search for long sub-sequences
Further optimized the n-grams Levenshtein search
Cython versions of the optimized parts of the n-grams Levenshtein search
0.5.0 (2017-09-05)
Fixed search_exact_byteslike() to support supplying start and end indexes
Added support for lists, tuples and other Sequence types to search_exact()
Fixed a bug where find_near_matches() could return a wrong Match.end with max_l_dist=0
Added more tests and improved some existing ones.
0.4.0 (2017-07-06)
Added support and testing for Python 3.5 and 3.6
Many small improvements to README, setup.py and CI testing
0.3.0 (2015-02-12)
Added C extensions for several search functions as well as internal functions
Use C extensions if available, or pure-Python implementations otherwise
setup.py attempts to build C extensions, but installs without if build fails
Added --noexts setup.py option to avoid trying to build the C extensions
Greatly improved testing and coverage
0.2.2 (2014-03-27)
Added support for searching through BioPython Seq objects
Added specialized search function allowing only subsitutions and insertions
Fixed several bugs
0.2.1 (2014-03-14)
Fixed major match grouping bug
0.2.0 (2013-03-13)
New utility function find_near_matches() for easier use
Additional documentation
0.1.0 (2013-11-12)
Two working implementations
Extensive test suite; all tests passing
Full support for Python 2.6-2.7 and 3.1-3.3
Bumped status from Pre-Alpha to Alpha
0.0.1 (2013-11-01)
First release on PyPI.
Release files for fuzzysearch 0.6.2
For a detailed explanation of source distributions (sdists) and built distributions (wheels), please see the package formats documentation.
Source distribution (sdist)
| File | Size | Uploaded | |
|---|---|---|---|
| fuzzysearch-0.6.2.tar.gz | 99.3 kB | Details |
Built distributions (wheels)
| File | Reset | |||
|---|---|---|---|---|
| fuzzysearch-0.6.2-cp37-cp37m-win_amd64.whl | CPython 3.7 | CPython 3.7 pymalloc | Windows x86-64 | Details |
| fuzzysearch-0.6.2-cp37-cp37m-win32.whl | CPython 3.7 | CPython 3.7 pymalloc | Windows x86-32 | Details |
| fuzzysearch-0.6.2-cp37-cp37m-macosx_10_9_x86_64.whl | CPython 3.7 | CPython 3.7 pymalloc | macOS 10.9+ x86-64 | Details |
| fuzzysearch-0.6.2-cp36-cp36m-win_amd64.whl | CPython 3.6 | CPython 3.6 pymalloc | Windows x86-64 | Details |
| fuzzysearch-0.6.2-cp36-cp36m-win32.whl | CPython 3.6 | CPython 3.6 pymalloc | Windows x86-32 | Details |
| fuzzysearch-0.6.2-cp36-cp36m-macosx_10_9_x86_64.whl | CPython 3.6 | CPython 3.6 pymalloc | macOS 10.9+ x86-64 | Details |
| fuzzysearch-0.6.2-cp35-cp35m-win_amd64.whl | CPython 3.5 | CPython 3.5 pymalloc | Windows x86-64 | Details |
| fuzzysearch-0.6.2-cp35-cp35m-win32.whl | CPython 3.5 | CPython 3.5 pymalloc | Windows x86-32 | Details |
| fuzzysearch-0.6.2-cp35-cp35m-macosx_10_6_intel.whl | CPython 3.5 | CPython 3.5 pymalloc | macOS 10.6+ Intel (x86-64, i386) | Details |
| fuzzysearch-0.6.2-cp34-cp34m-win32.whl | CPython 3.4 | CPython 3.4 pymalloc | Windows x86-32 | Details |
| fuzzysearch-0.6.2-cp34-cp34m-macosx_10_6_intel.whl | CPython 3.4 | CPython 3.4 pymalloc | macOS 10.6+ Intel (x86-64, i386) | Details |
| fuzzysearch-0.6.2-cp27-cp27m-win_amd64.whl | CPython 2.7 | CPython 2.7 pymalloc | Windows x86-64 | Details |
| fuzzysearch-0.6.2-cp27-cp27m-win32.whl | CPython 2.7 | CPython 2.7 pymalloc | Windows x86-32 | Details |
| fuzzysearch-0.6.2-cp27-cp27m-macosx_10_9_x86_64.whl | CPython 2.7 | CPython 2.7 pymalloc | macOS 10.9+ x86-64 | Details |
Total release size: 1.2 MB
Release files / fuzzysearch-0.6.2.tar.gz
| Download URL | fuzzysearch-0.6.2.tar.gz |
|---|---|
| Size | 99.3 kB |
| Tags | Source |
|
SHA-256 checksum How to use checksums |
1352840b157d708aa5f68ad47c7161f50f6c314e74f686fc59655fffeb338d58
|
|
BLAKE2b-256 checksum How to use checksums |
84a4ae12fef8f50332419291f40c0faeb2af1e24804faabcc6e386a9c854a4db
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.12.1 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp37-cp37m-win_amd64.whl
| Download URL | fuzzysearch-0.6.2-cp37-cp37m-win_amd64.whl |
|---|---|
| Size | 77.9 kB |
| Tags | CPython 3.7 CPython 3.7 pymalloc Windows x86-64 |
|
SHA-256 checksum How to use checksums |
937b288867bfff2cd00c771457e5b8934df8a3ecdad9c318ae3008198fcd4d16
|
|
BLAKE2b-256 checksum How to use checksums |
8d16e5dfc9be4d600c2bd383879c66f5c4a3b07c141f96b0e1e920ec77b43f69
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp37-cp37m-win32.whl
| Download URL | fuzzysearch-0.6.2-cp37-cp37m-win32.whl |
|---|---|
| Size | 70.5 kB |
| Tags | CPython 3.7 CPython 3.7 pymalloc Windows x86-32 |
|
SHA-256 checksum How to use checksums |
b538c723b2e0cc49ba6f972c061341316ffab72392e936a51605b1b41167de41
|
|
BLAKE2b-256 checksum How to use checksums |
22fc3fc848cc1f1f33410333f8e35a573b22fba4ced7ada7ee42cb7d0238552f
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp37-cp37m-macosx_10_9_x86_64.whl
| Download URL | fuzzysearch-0.6.2-cp37-cp37m-macosx_10_9_x86_64.whl |
|---|---|
| Size | 75.4 kB |
| Tags | CPython 3.7 CPython 3.7 pymalloc macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
f91e5846936b51626b00bfd6c20f4a291b8c3a5d2ce5114279e27590ed07a3ae
|
|
BLAKE2b-256 checksum How to use checksums |
494d80eccf101b994d2f67bd56f147921557ad8bff6c158c2ee0c9f71de6ff03
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/41.0.1 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.3
|
Release files / fuzzysearch-0.6.2-cp36-cp36m-win_amd64.whl
| Download URL | fuzzysearch-0.6.2-cp36-cp36m-win_amd64.whl |
|---|---|
| Size | 77.7 kB |
| Tags | CPython 3.6 CPython 3.6 pymalloc Windows x86-64 |
|
SHA-256 checksum How to use checksums |
644bccfdac9e3f859723d19606871c2363881b8d34eddb3402d21fba38f8f2ba
|
|
BLAKE2b-256 checksum How to use checksums |
a8fc821362563dfc9c7bb48e7e3dd9363ba772ec32929c721ccaf6f45d23d16c
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp36-cp36m-win32.whl
| Download URL | fuzzysearch-0.6.2-cp36-cp36m-win32.whl |
|---|---|
| Size | 70.4 kB |
| Tags | CPython 3.6 CPython 3.6 pymalloc Windows x86-32 |
|
SHA-256 checksum How to use checksums |
05956ae6ee66abad512f879ad168f7deb1479b0e1f42406e840c66f480572cd7
|
|
BLAKE2b-256 checksum How to use checksums |
a426d3e2ba56476cf4f826e576245ab46dcea0b2eb092e0333762d2617567b07
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp36-cp36m-macosx_10_9_x86_64.whl
| Download URL | fuzzysearch-0.6.2-cp36-cp36m-macosx_10_9_x86_64.whl |
|---|---|
| Size | 74.9 kB |
| Tags | CPython 3.6 CPython 3.6 pymalloc macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
90f7e2f3fde3cb24151d826ff6f4d50192e7830bcf22c9d8ede23df6dd45abd5
|
|
BLAKE2b-256 checksum How to use checksums |
f968b0b42068d5a30b173ed929eb30dc441083fb166bc6b1c082841b51b7d319
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/41.0.1 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.3
|
Release files / fuzzysearch-0.6.2-cp35-cp35m-win_amd64.whl
| Download URL | fuzzysearch-0.6.2-cp35-cp35m-win_amd64.whl |
|---|---|
| Size | 76.6 kB |
| Tags | CPython 3.5 CPython 3.5 pymalloc Windows x86-64 |
|
SHA-256 checksum How to use checksums |
b8479a57232b309235a84450f4a37c3ee8ed69bd8c50460edd52e204a479dbee
|
|
BLAKE2b-256 checksum How to use checksums |
42c273f584091a81d2a911f81b3515663b3212ac27bdb7e404e3c85562d76b67
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp35-cp35m-win32.whl
| Download URL | fuzzysearch-0.6.2-cp35-cp35m-win32.whl |
|---|---|
| Size | 69.3 kB |
| Tags | CPython 3.5 CPython 3.5 pymalloc Windows x86-32 |
|
SHA-256 checksum How to use checksums |
3385da3c04f4e25b6e49a3f6cf4b3f270d5d808031d0f33f7673bb8578d3fd7b
|
|
BLAKE2b-256 checksum How to use checksums |
a19a2cea7e0485774e9383bb3a3239bbf7dc083316157eda2630135d3faf3b96
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp35-cp35m-macosx_10_6_intel.whl
| Download URL | fuzzysearch-0.6.2-cp35-cp35m-macosx_10_6_intel.whl |
|---|---|
| Size | 124.3 kB |
| Tags | CPython 3.5 CPython 3.5 pymalloc macOS 10.6+ Intel (x86-64, i386) |
|
SHA-256 checksum How to use checksums |
ba0136309145a461755d16ec17b5c0be29819948944edfe06434a17e13d3ca45
|
|
BLAKE2b-256 checksum How to use checksums |
1de456f3f297086589174e1ef269d7c93aef03723243807a85c132005a83ac6e
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/41.0.1 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.3
|
Release files / fuzzysearch-0.6.2-cp34-cp34m-win32.whl
| Download URL | fuzzysearch-0.6.2-cp34-cp34m-win32.whl |
|---|---|
| Size | 64.9 kB |
| Tags | CPython 3.4 CPython 3.4 pymalloc Windows x86-32 |
|
SHA-256 checksum How to use checksums |
925ae4b6bec9c09645221310e07b2ef86a0aa020d4b18eedbe798253a25d7d5d
|
|
BLAKE2b-256 checksum How to use checksums |
50f8e3fff7e60a7a347adf934be5a601681a102168555901ca24d6f9a1881087
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp34-cp34m-macosx_10_6_intel.whl
| Download URL | fuzzysearch-0.6.2-cp34-cp34m-macosx_10_6_intel.whl |
|---|---|
| Size | 123.4 kB |
| Tags | CPython 3.4 CPython 3.4 pymalloc macOS 10.6+ Intel (x86-64, i386) |
|
SHA-256 checksum How to use checksums |
fd0dff10cfa1b1beb7c046b9ab6a4f10a5c6f027cd265fa4f30ea5e0d54cbbab
|
|
BLAKE2b-256 checksum How to use checksums |
1bbb94a5702efee5c082d3f46d3668892f3f538f097506d241531c6ba57d6aa3
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/41.0.1 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.3
|
Release files / fuzzysearch-0.6.2-cp27-cp27m-win_amd64.whl
| Download URL | fuzzysearch-0.6.2-cp27-cp27m-win_amd64.whl |
|---|---|
| Size | 67.1 kB |
| Tags | CPython 2.7 CPython 2.7 pymalloc Windows x86-64 |
|
SHA-256 checksum How to use checksums |
5d6dafb14b989c5eab686a57355f1b2ba8d85dea164a455e4ea358cc6f7612de
|
|
BLAKE2b-256 checksum How to use checksums |
18ee54e69e754948c3683c1f5b2ddea2db32e4d319e237b8c6035b039c192726
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp27-cp27m-win32.whl
| Download URL | fuzzysearch-0.6.2-cp27-cp27m-win32.whl |
|---|---|
| Size | 64.1 kB |
| Tags | CPython 2.7 CPython 2.7 pymalloc Windows x86-32 |
|
SHA-256 checksum How to use checksums |
160dd0e1af8910a9cb0a70837247fe04f65faa0e4a9ba9a2aed9f862f2416559
|
|
BLAKE2b-256 checksum How to use checksums |
97913558fe9fce065cb93ac225b91492c63da9409d7311f619b91d39e460d4ee
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.4.2 requests/2.18.4 setuptools/40.6.2 requests-toolbelt/0.8.0 tqdm/4.28.1 CPython/3.6.3
|
Release files / fuzzysearch-0.6.2-cp27-cp27m-macosx_10_9_x86_64.whl
| Download URL | fuzzysearch-0.6.2-cp27-cp27m-macosx_10_9_x86_64.whl |
|---|---|
| Size | 71.9 kB |
| Tags | CPython 2.7 CPython 2.7 pymalloc macOS 10.9+ x86-64 |
|
SHA-256 checksum How to use checksums |
0a33cfd97e15a71182cea638b15c9873b730f361cc2a13a4c36152d667ef918e
|
|
BLAKE2b-256 checksum How to use checksums |
91af4bebf200cbba71588b78515bd5ab4480d716f406749f2a997df959c4bddb
|
| Upload date | |
|
Uploaded using Trusted Publishing? What is trusted publishing? |
No |
| Uploaded via |
twine/1.13.0 pkginfo/1.5.0.1 requests/2.21.0 setuptools/41.0.1 requests-toolbelt/0.9.1 tqdm/4.31.1 CPython/3.7.3
|