Installation

$ pip install fuzzysearch

This will work even if installing the C and Cython extensions fails, using pure-Python fallbacks.

Usage

Just call find_near_matches() with the sub-sequence you’re looking for, the sequence to search, and the matching parameters:

>>> from fuzzysearch import find_near_matches
# search for 'PATTERN' with a maximum Levenshtein Distance of 1
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1)]

>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' # distance = 1
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1)]

Matching Criteria

The search function supports four possible match criteria, which may be supplied in any combination:

• maximum Levenshtein distance (max_l_dist)

• maximum # of subsitutions

• maximum # of deletions (“delete” = skip a character in the sub-sequence)

• maximum # of insertions (“insert” = skip a character in the sequence)

Not supplying a criterion means that there is no limit for it. For this reason, one must always supply max_l_dist and/or all other criteria.

>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1)]

# this will not match since max-deletions is set to zero
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1, max_deletions=0)
[]

# note that a deletion + insertion may be combined to match a substution
>>> find_near_matches('PATTERN', '---PAT-ERN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=1)] # the Levenshtein distance is still 1

# ... but deletion + insertion may also match other, non-substitution differences
>>> find_near_matches('PATTERN', '---PATERRN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=2)]

History