This is a pre-production deployment of Warehouse, however changes made here WILL affect the production instance of PyPI.
Latest Version Dependencies status unknown Test status unknown Test coverage unknown
Project Description
# GraftM
GraftM is a tool for finding genes of interest in metagenomes, metatranscriptomes, and whole genomes.

Using modular gene packages, GraftM will search the provided sequences using hmmsearch (HMMER) and place the identified sequences into a pre-constructed phylogenetic tree. The provides fast, phylogenetically informed community profiles and genome annotations. GraftM provides tools to:
* Create and update custom gene packages to use with GraftM
* Decorate trees, and of course..
* Analyse sequence datasets using these GraftM packages
Head over to the [GraftM page](http://geronimp.github.io/graftM/) for more general information.

### Installation
#### pip installation
GraftM can be installed via pip:
```
pip install graftm
```
However, to use all features of GraftM a few extra binary applications are required:
* orfm v. >= 0.2.0 (https://github.com/wwood/OrfM)
* hmmer v. >= 3.1b1 (http://hmmer.janelia.org/)
* fxtract (https://github.com/ctSkennerton/fxtract)
* pplacer v. >= 2.6.32 (http://matsen.fhcrc.org/pplacer/)
* krona v. >= 2.4 (http://sourceforge.net/p/krona/home/krona/)
* mafft v. >= 7.22 (http://mafft.cbrc.jp/)
* diamond v. >= 0.7.9 (https://github.com/bbuchfink/diamond)

To create new GraftM packages, you'll also need
* FastTreeMP (http://www.microbesonline.org/fasttree/)

#### Docker images
Versions of graftM on pip now have matching docker images as of GraftM v0.9.2. GraftM docker images are portable containers that contain the graftM code and all its python and non-python dependancies, allowing GraftM to be run on any platform with docker installed. Details on how to download and run a GraftM docker image can be found on the [graftm-docker](https://github.com/geronimp/graftM-docker) GitHub page or the [docker hub page](https://hub.docker.com/u/geronimp/)

### Manual
A [manual](https://github.com/geronimp/graftM/wiki) is available in the form of the wiki here on GitHub.

### GraftM packages
We have a starter pack of graftM packages available including:

* 16S rRNA packages
* 15 single copy ribosomal protein marker genes
* The methanogenesis marker mcrA

All are available at the [GraftM package database store](https://drive.google.com/open?id=0BwJ4AwdqUiTzfndmRXowX3MydkM5bG1PYmxRUjNmMUNnazdFaUJaWjJFSkh1UEFDSkpReU0)

Once you have downloaded the package you want, just decompress it as follows:

```
tar -xvzf my.tar.gz
```
And you should be good to go!



### Example
As an example, we'll use GraftM to classify a single 16S sequence from GreenGenes. Saving the example file as `/tmp/eg.fasta` with the following contents:
```
>229854
GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCATGACTTAGCTTGCT
AAGTTGATGGCGAGTGGCGAACGGGTGAGTAACGCGTAGGAATATGCCTTAAAGAGGGGGACAACTTGGGGAAACTCAAG
CTAATACCGCATAAACTCTTCGGAGAAAAGCTGGGGACTTTCGAGCCTGGCGCTTTAAGATTAGCCTGCGTCCGATTAGC
```
Then we can use GraftM's 61% OTU clustered GraftM package to detect and classify this sequence. Running graftM might look something like this:
```
$ graftM graft --forward /tmp/eg.fasta --graftm_package /path/to/4.01.2013_08_greengenes_61_otus.gpkg/ --output_directory eg.graftm

GraftM 0.9.2

GRAFT

Joel Boyd, Ben Woodcroft

__/__
______|
_- - _ ________| |_____/
- - - | |____/_
- _ >>>> - >>>> ____|
- _- - - | ______
- _ |_____|
- |______

12/02/2015 09:52:06 AM INFO: Working on eg
12/02/2015 09:52:06 AM INFO: 1 read(s) detected
12/02/2015 09:52:06 AM INFO: aligning reads to reference package database
12/02/2015 09:52:06 AM INFO: Filtered 0 short sequences from the alignment
12/02/2015 09:52:06 AM INFO: 1 sequences remaining
12/02/2015 09:52:06 AM INFO: Placing reads into phylogenetic tree
12/02/2015 09:52:07 AM INFO: Placements finished
12/02/2015 09:52:07 AM INFO: Reading classifications
12/02/2015 09:52:07 AM INFO: Reads classified
12/02/2015 09:52:07 AM INFO: Writing summary table
12/02/2015 09:52:07 AM INFO: Writing biom file
12/02/2015 09:52:07 AM INFO: Building summary krona plot
12/02/2015 09:52:07 AM INFO: Cleaning up
12/02/2015 09:52:07 AM INFO: Done, thanks for using graftM!
```
This creates a folder `eg.graftm` which contains the results.

### Contact
If you have any further comments, complaints or recomendations about GraftM, drop an email to the [SupportM](https://groups.google.com/forum/?hl=en#!forum/supportm) public help forum.
Software by [Joel A. Boyd](http://ecogenomic.org/users/joel-boyd) (@geronimp) and [Ben J. Woodcroft](http://www.ecogenomic.org/users/ben-woodcroft) (@wwood) at the [Australian Centre for Ecogenomics](http://ecogenomic.org)
Released under GPL3 - see LICENCE.txt for licencing details
Release History

Release History

0.9.5

This version

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.9.4

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.9.3

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.9.2

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.9.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.9.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.6.3

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.6.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.6.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.4

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.3

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.2

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.1

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

0.5.0

History Node

TODO: Figure out how to actually get changelog content.

Changelog content for this version goes here.

Donec et mollis dolor. Praesent et diam eget libero egestas mattis sit amet vitae augue. Nam tincidunt congue enim, ut porta lorem lacinia consectetur. Donec ut libero sed arcu vehicula ultricies a non tortor. Lorem ipsum dolor sit amet, consectetur adipiscing elit.

Show More

Download Files

Download Files

TODO: Brief introduction on what you do with files - including link to relevant help section.

File Name & Checksum SHA256 Checksum Help Version File Type Upload Date
graftm-0.9.5.tar.gz (219.5 kB) Copy SHA256 Checksum SHA256 Source May 17, 2016

Supported By

WebFaction WebFaction Technical Writing Elastic Elastic Search Pingdom Pingdom Monitoring Dyn Dyn DNS HPE HPE Development Sentry Sentry Error Logging CloudAMQP CloudAMQP RabbitMQ Heroku Heroku PaaS Kabu Creative Kabu Creative UX & Design Fastly Fastly CDN DigiCert DigiCert EV Certificate Rackspace Rackspace Cloud Servers DreamHost DreamHost Log Hosting