Skip to main content

Exact reproduction of the NEB Tm Calculator for PCR primer analysis with all NEB polymerases

Project description

polymerase-tm

Exact Python reproduction of the NEB Tm Calculator for PCR primer melting temperature (Tm) and annealing temperature (Ta) prediction.

Features

  • Exact NEB Tm Calculator reproduction -- algorithm reverse-engineered from the NEB Tm Calculator front-end source; verified against the official tool with 0 degC deviation across all tested sequences.
  • 22 NEB polymerase products with their specific buffer salt concentrations and Ta rules (Q5, Phusion, Taq, OneTaq, LongAmp, Vent, Deep Vent, and more).
  • DMSO recommendation -- analyses primer hairpins, amplicon GC content, GC-rich hotspots, and template secondary structures.
  • CLI tool (polymerase-tm) for quick calculations from the terminal.
  • No dependencies for core Tm/Ta calculations. Biopython is optional (only needed for reading GenBank template files in DMSO analysis).

Installation

# From PyPI
pip install polymerase-tm

# With Biopython support (for GenBank template analysis)
pip install polymerase-tm[bio]

# From conda-forge (when available)
mamba install -c conda-forge polymerase-tm

Quick Start

Python API

from polymerase_tm import tm, ta, dmso_recommendation

# Single primer Tm (Q5, 500 nM)
print(tm("ATGTCCCTGCTCTTCTCTCGATGCAA"))          # 72

# Primer pair Ta
result_ta, tm_fwd, tm_rev = ta(
    "ATGTCCCTGCTCTTCTCTCGATGCAA",
    "GTGCCTCCGAGCCAGCACC",
)
print(f"Ta = {result_ta}, Fwd Tm = {tm_fwd}, Rev Tm = {tm_rev}")
# Ta = 72, Fwd Tm = 72, Rev Tm = 75

# Different polymerase
print(tm("ATGTCCCTGCTCTTCTCTCGATGCAA", polymerase="taq"))

# Ta with 3% DMSO
ta_dmso, _, _ = ta("ATGTCCCTGCTCTTCTCTCGATGCAA", "GTGCCTCCGAGCCAGCACC", dmso_pct=3)
print(f"Ta with 3% DMSO = {ta_dmso}")  # 70

# List all available polymerases
from polymerase_tm import list_polymerases
for p in list_polymerases():
    print(f"{p['key']:25s} {p['description']}")

DMSO Analysis

from polymerase_tm import dmso_recommendation, print_dmso_report

report = dmso_recommendation(
    fwd_bind="ATGTCCCTGCTCTTCTCTCGATGCAA",
    rev_bind="GTGCCTCCGAGCCAGCACC",
    template_file="template.gbk",     # optional, requires biopython
)
print_dmso_report(report)

Command Line

# Single primer Tm
polymerase-tm ATGTCCCTGCTCTTCTCTCGATGCAA

# Primer pair Ta
polymerase-tm ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC

# Different polymerase
polymerase-tm --polymerase taq ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC

# With DMSO correction
polymerase-tm --dmso 3 ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC

# List all polymerases
polymerase-tm --list

# DMSO analysis with template
polymerase-tm --dmso-check --template template.gbk ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC

Algorithm

Component Method Reference
Nearest-neighbor Tm SantaLucia (1998) PNAS 95:1460-5
Salt correction Owczarzy et al. (2004) Biochemistry 43:3537-54
Ta rules Polymerase-specific NEB Tm Calculator v1.16
DMSO correction -0.6 degC per 1% NEB Tm Calculator v1.16

Buffer Salt Concentrations

Buffer [Monovalent] (mM) Used by
Q5 150 Q5, Q5 Hot Start, Q5 Blood Direct
Q5U 170 Q5U Hot Start
Q5 Master Mix 150 Q5 2X Master Mix
Phusion HF / GC 222 Phusion, Phusion Hot Start Flex
Standard Taq 55 Taq, Hot Start Taq, EpiMark
ThermoPol 40 Vent, Deep Vent
OneTaq Std 54 OneTaq (Standard Buffer)
OneTaq GC 80 OneTaq (GC Buffer)
LongAmp 100 LongAmp, LongAmp Hot Start
Crimson Taq 55 Crimson Taq
Hemo KlenTaq 70 Hemo KlenTaq
Multiplex 90 Multiplex PCR Master Mix

Ta Calculation Rules

Polymerase family Rule Cap
Q5 min(Tm1, Tm2) + 1 72 degC
Q5U min(Tm1, Tm2) + 2 72 degC
Phusion 0.93 * min(Tm1, Tm2) + 7.5 72 degC
Taq / OneTaq min(Tm1, Tm2) - 5 68 degC
LongAmp min(Tm1, Tm2) - 5 65 degC
Vent / Deep Vent min(Tm1, Tm2) - 2 72 degC

Disclaimer

This package is not affiliated with New England Biolabs (NEB). The algorithm was reverse-engineered from the publicly available JavaScript source of the NEB Tm Calculator for research and educational purposes. Always verify critical calculations against the official tool.

License

MIT

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

polymerase_tm-0.4.0.tar.gz (15.7 kB view details)

Uploaded Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

polymerase_tm-0.4.0-py3-none-any.whl (16.6 kB view details)

Uploaded Python 3

File details

Details for the file polymerase_tm-0.4.0.tar.gz.

File metadata

  • Download URL: polymerase_tm-0.4.0.tar.gz
  • Upload date:
  • Size: 15.7 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.7

File hashes

Hashes for polymerase_tm-0.4.0.tar.gz
Algorithm Hash digest
SHA256 7f06ba606b6527254d291bac807281e54ef5e5e8d8ad395e1444d62d55afb01e
MD5 4071641745805a82f670ae402d7336de
BLAKE2b-256 3034e26a0cb909a28a119b2582b0172e343621a8e1eef7ee47afc59cf2cac16b

See more details on using hashes here.

Provenance

The following attestation bundles were made for polymerase_tm-0.4.0.tar.gz:

Publisher: publish.yml on Dioskurides/polymerase-tm

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

File details

Details for the file polymerase_tm-0.4.0-py3-none-any.whl.

File metadata

  • Download URL: polymerase_tm-0.4.0-py3-none-any.whl
  • Upload date:
  • Size: 16.6 kB
  • Tags: Python 3
  • Uploaded using Trusted Publishing? Yes
  • Uploaded via: twine/6.1.0 CPython/3.13.7

File hashes

Hashes for polymerase_tm-0.4.0-py3-none-any.whl
Algorithm Hash digest
SHA256 12f7d977150b39b11f3f4dc9ccaf4f2211d76994099d7b1f294c036046820a27
MD5 7499336bdbd8a9818d3aa965d7132e82
BLAKE2b-256 417cb161c1eef3f909354a92b93bbf3dc080569468bb52e67fee7f3f621703f6

See more details on using hashes here.

Provenance

The following attestation bundles were made for polymerase_tm-0.4.0-py3-none-any.whl:

Publisher: publish.yml on Dioskurides/polymerase-tm

Attestations: Values shown here reflect the state when the release was signed and may no longer be current.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page