polymerase-tm 0.5.0

Exact reproduction of the NEB Tm Calculator for PCR primer analysis with all NEB polymerases

polymerase-tm

Exact Python reproduction of the NEB Tm Calculator for PCR primer melting temperature (Tm) and annealing temperature (Ta) prediction.

Features

• Exact NEB Tm Calculator reproduction -- algorithm reverse-engineered from the NEB Tm Calculator front-end source; verified against the official tool with 0 degC deviation across all tested sequences.
• 22 NEB polymerase products with their specific buffer salt concentrations and Ta rules (Q5, Phusion, Taq, OneTaq, LongAmp, Vent, Deep Vent, and more).
• Automatic additive recommendation -- suggests Q5 High GC Enhancer or DMSO based on primer GC, hairpins, and amplicon analysis.
• Batch processing -- process hundreds of primer pairs from CSV files with full Tm/Ta/compatibility analysis.
• PCR protocol generator -- generates complete cycling protocols with polymerase-specific temperatures and extension times.
• Smart primer design -- find the optimal binding length for a target Tm.
• Primer dimer detection -- checks 3'-end complementarity and self-dimer risk.
• Gibson Assembly overlap design -- generates full primers with overhangs for Gibson/HiFi Assembly.
• Restriction site scanning -- scans primers for 14 common restriction enzyme sites (customizable).
• Primer quality scoring -- comprehensive 0-100 score evaluating GC clamp, runs, repeats, hairpins.
• DMSO analysis -- analyses primer hairpins, amplicon GC content, GC-rich hotspots, and template secondary structures.
• CLI tool (polymerase-tm) for quick calculations from the terminal.

Dependencies: Biopython (for GenBank template analysis in DMSO features).

Installation

pip install polymerase-tm

# From conda-forge (when available)
mamba install -c conda-forge polymerase-tm

Quick Start

Python API

from polymerase_tm import tm, ta

# Single primer Tm (Q5, 500 nM)
print(tm("ATGTCCCTGCTCTTCTCTCGATGCAA"))          # 72

# Primer pair Ta
result_ta, tm_fwd, tm_rev = ta(
    "ATGTCCCTGCTCTTCTCTCGATGCAA",
    "GTGCCTCCGAGCCAGCACC",
)
print(f"Ta = {result_ta}, Fwd Tm = {tm_fwd}, Rev Tm = {tm_rev}")
# Ta = 72, Fwd Tm = 72, Rev Tm = 75

# Different polymerase
print(tm("ATGTCCCTGCTCTTCTCTCGATGCAA", polymerase="taq"))

# Ta with 3% DMSO
ta_dmso, _, _ = ta("ATGTCCCTGCTCTTCTCTCGATGCAA", "GTGCCTCCGAGCCAGCACC", dmso_pct=3)
print(f"Ta with 3% DMSO = {ta_dmso}")  # 70

# List all available polymerases
from polymerase_tm import list_polymerases
for p in list_polymerases():
    print(f"{p['key']:25s} {p['description']}")

Automation & Batch Processing

from polymerase_tm import (
    batch_tm,                 # Bulk Tm for many sequences
    optimal_binding_length,   # Find shortest binding region for target Tm
    check_pair,               # Full primer pair compatibility report
    pcr_protocol,             # Generate complete PCR cycling protocol
    reverse_complement,       # DNA reverse complement
    from_csv, to_csv,         # CSV batch I/O
)

# Batch Tm for multiple primers
results = batch_tm(["ATCGATCGATCG", "GCGCGCGCGCGC", "AATTCCGGAATT"])
for r in results:
    print(f"{r['sequence']}: Tm={r['tm']} degC, GC={r['gc_pct']}%")

# Find optimal binding length for a target Tm
result = optimal_binding_length("ATGTCCCTGCTCTTCTCTCGATGCAA", target_tm=65)
print(f"{result['binding_seq']} ({result['length']} nt, Tm={result['tm']})")
# CCTGCTCTTCTCTCGATGCAA (21 nt, Tm=67)

# Primer pair compatibility check (includes auto additive recommendation)
pair = check_pair("ATGTCCCTGCTCTTCTCTCGATGCAA", "GTGCCTCCGAGCCAGCACC")
print(f"Ta={pair['ta']}, compatible={pair['compatible']}")
if pair["additive"]["recommended"]:
    print(f"Use {pair['additive']['additive']} ({pair['additive']['concentration']})")
    # -> "Use Q5 High GC Enhancer (1x)" for Q5 with high-GC primers
    # -> "Use DMSO (3%)" for Taq with high-GC primers

# Generate full PCR cycling protocol
protocol = pcr_protocol(
    "ATGTCCCTGCTCTTCTCTCGATGCAA",
    "GTGCCTCCGAGCCAGCACC",
    amplicon_length=2500,
)
for step in protocol["cycling"]:
    print(f"{step['step']:25s} {step['temp']} degC  {step['time']}")
# Initial Denaturation       98 degC  30 s
# Denaturation               98 degC  10 s
# Annealing                  72 degC  30 s
# Extension                  72 degC  1 min 15 s
# Final Extension            72 degC  2 min
# Hold                        4 degC  indefinite

# CSV pipeline: read primers, compute everything, write results
results = from_csv("primers.csv")  # expects columns: name, fwd, rev
to_csv(results, "results_with_tm.csv")

DMSO Analysis

from polymerase_tm import dmso_recommendation, print_dmso_report

report = dmso_recommendation(
    fwd_bind="ATGTCCCTGCTCTTCTCTCGATGCAA",
    rev_bind="GTGCCTCCGAGCCAGCACC",
    template_file="template.gbk",     # optional GenBank template
)
print_dmso_report(report)

Command Line

# Single primer Tm
polymerase-tm ATGTCCCTGCTCTTCTCTCGATGCAA

# Primer pair Ta (includes auto additive recommendation)
polymerase-tm ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC

# Different polymerase
polymerase-tm --polymerase taq ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC

# With DMSO correction
polymerase-tm --dmso 3 ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC

# List all polymerases
polymerase-tm --list

# DMSO analysis with template
polymerase-tm --dmso-check --template template.gbk FWD_SEQ REV_SEQ

# Version
polymerase-tm --version

API Reference

Function	Description
tm(seq, polymerase)	Melting temperature for one primer
ta(seq1, seq2, polymerase, dmso_pct)	Annealing temperature for a primer pair
batch_tm(sequences, polymerase)	Batch Tm for multiple sequences
check_pair(fwd, rev, polymerase)	Pair compatibility + additive recommendation
pcr_protocol(fwd, rev, polymerase, amplicon_length)	Full PCR cycling protocol
optimal_binding_length(seq, target_tm, polymerase)	Find shortest binding region for target Tm
reverse_complement(seq)	DNA reverse complement
from_csv(path, polymerase)	Read primer pairs from CSV, compute Tm/Ta
to_csv(results, path)	Write results to CSV
list_polymerases()	List all 22 supported polymerases
primer_dimer(fwd, rev)	Check 3' complementarity / dimer risk
gibson_overlaps(fwd_bind, rev_bind, left_seq, right_seq)	Design Gibson/HiFi Assembly primers
restriction_scan(seq, enzymes)	Scan for restriction sites (14 default enzymes)
primer_quality(seq)	Quality score 0-100 with issues list
dmso_recommendation(fwd, rev, template)	Full DMSO/additive analysis
gc_content(seq)	GC content as fraction

Algorithm

Component	Method	Reference
Nearest-neighbor Tm	SantaLucia (1998)	PNAS 95:1460-5
Salt correction	Owczarzy et al. (2004)	Biochemistry 43:3537-54
Ta rules	Polymerase-specific	NEB Tm Calculator v1.16
DMSO correction	-0.6 degC per 1%	NEB Tm Calculator v1.16

Buffer Salt Concentrations

Buffer	[Monovalent] (mM)	Used by
Q5	150	Q5, Q5 Hot Start, Q5 Blood Direct
Q5U	170	Q5U Hot Start
Q5 Master Mix	150	Q5 2X Master Mix
Phusion HF / GC	222	Phusion, Phusion Hot Start Flex
Standard Taq	55	Taq, Hot Start Taq, EpiMark
ThermoPol	40	Vent, Deep Vent
OneTaq Std	54	OneTaq (Standard Buffer)
OneTaq GC	80	OneTaq (GC Buffer)
LongAmp	100	LongAmp, LongAmp Hot Start
Crimson Taq	55	Crimson Taq
Hemo KlenTaq	70	Hemo KlenTaq
Multiplex	90	Multiplex PCR Master Mix

Ta Calculation Rules

Polymerase family	Rule	Cap
Q5	min(Tm1, Tm2) + 1	72 degC
Q5U	min(Tm1, Tm2) + 2	72 degC
Phusion	0.93 * min(Tm1, Tm2) + 7.5	72 degC
Taq / OneTaq	min(Tm1, Tm2) - 5	68 degC
LongAmp	min(Tm1, Tm2) - 5	65 degC
Vent / Deep Vent	min(Tm1, Tm2) - 2	72 degC

Disclaimer

This package is not affiliated with New England Biolabs (NEB). The algorithm was reverse-engineered from the publicly available JavaScript source of the NEB Tm Calculator for research and educational purposes. Always verify critical calculations against the official tool.

License

MIT