NEB Tm Calculator + Base Changer: PCR primer Tm/Ta and site-directed mutagenesis primer design for all NEB polymerases
Project description
polymerase-tm
Exact Python reproduction of the NEB Tm Calculator and NEB Base Changer for PCR primer melting temperature (Tm), annealing temperature (Ta), and site-directed mutagenesis (SDM) primer design.
Features
- Exact NEB Tm Calculator reproduction -- algorithm reverse-engineered from the NEB Tm Calculator front-end source; verified against the official tool with 0 degC deviation across all tested sequences.
- Zero dependencies for core functions --
tm(),ta(),batch_tm(),check_pair(), and all primer analysis work without any external packages. - 22 NEB polymerase products with their specific buffer salt concentrations and Ta rules (Q5, Phusion, Taq, OneTaq, LongAmp, Vent, Deep Vent, and more).
- Automatic additive recommendation -- suggests Q5 High GC Enhancer or DMSO based on primer GC, hairpins, and amplicon analysis.
- Batch processing -- process hundreds of primer pairs from CSV files with full Tm/Ta/compatibility analysis.
- PCR protocol generator -- generates complete cycling protocols with polymerase-specific temperatures and extension times. Automatically generates touchdown protocols when primer Tm difference exceeds 3 degC.
- Smart primer design -- find the optimal binding length for a target Tm.
- Primer dimer detection -- checks 3'-end complementarity and self-dimer risk.
- Gibson Assembly overlap design -- generates full primers with overhangs for Gibson/HiFi Assembly.
- Restriction site scanning -- scans primers for ~120 NEB restriction enzyme sites with full IUPAC ambiguity code support (accepts enzyme names or custom dict).
- Primer quality scoring -- comprehensive 0-100 score evaluating GC clamp, runs, repeats, hairpins.
- Hairpin detection -- nearest-neighbor thermodynamic Tm for hairpin stems (SantaLucia 1998), G-T wobble pair tolerance, loop entropy penalty (Jacobson-Stockmayer).
- Site-directed mutagenesis -- reimplementation of the NEB Base Changer v2.7.2 primer design algorithm. Supports AA point mutations, nucleotide substitutions/deletions/insertions, 12 NCBI genetic codes, codon usage/parsimony selection, back-to-back primer design with Owczarzy (2008) bivariate salt correction (Na+ + Mg2+).
- DMSO analysis -- analyses primer hairpins, amplicon GC content, GC-rich hotspots, and template secondary structures (requires
[bio]extra for GenBank files). - Virtual gel visualization -- simulated agarose gel with realistic Ferguson-plot migration physics (requires
[viz]extra). - CLI tool (
polymerase-tm) for quick calculations from the terminal.
Optional dependencies: Biopython (for GenBank template analysis), matplotlib + seaborn (for virtual gel).
Installation
# Core package (zero dependencies)
pip install polymerase-tm
# With GenBank template support (adds biopython)
pip install polymerase-tm[bio]
# With virtual gel visualization (adds matplotlib, seaborn)
pip install polymerase-tm[viz]
# Everything
pip install polymerase-tm[all]
# From conda-forge (when available)
mamba install -c conda-forge polymerase-tm
Quick Start
Python API
from polymerase_tm import tm, ta, list_buffers
# Single primer Tm (Q5, 500 nM)
print(tm("ATGTCCCTGCTCTTCTCTCGATGCAA")) # 72
# Primer pair Ta
result_ta, tm_fwd, tm_rev = ta(
"ATGTCCCTGCTCTTCTCTCGATGCAA",
"GTGCCTCCGAGCCAGCACC",
)
print(f"Ta = {result_ta}, Fwd Tm = {tm_fwd}, Rev Tm = {tm_rev}")
# Ta = 72, Fwd Tm = 72, Rev Tm = 75
# Different polymerase
print(tm("ATGTCCCTGCTCTTCTCTCGATGCAA", polymerase="taq"))
# Override buffer (when not using default master mix)
print(tm("ATGTCCCTGCTCTTCTCTCGATGCAA", polymerase="taq", buffer="thermopol"))
# Direct salt concentration (mM)
print(tm("ATGTCCCTGCTCTTCTCTCGATGCAA", salt_mM=50))
# List all available buffers
for b in list_buffers():
print(f"{b['name']:20s} {b['salt_mM']:>4d} mM")
# Ta with 3% DMSO
ta_dmso, _, _ = ta("ATGTCCCTGCTCTTCTCTCGATGCAA", "GTGCCTCCGAGCCAGCACC", dmso_pct=3)
print(f"Ta with 3% DMSO = {ta_dmso}") # 70
# List all available polymerases
from polymerase_tm import list_polymerases
for p in list_polymerases():
print(f"{p['key']:25s} {p['description']}")
Automation & Batch Processing
from polymerase_tm import (
batch_tm, # Bulk Tm for many sequences
optimal_binding_length, # Find shortest binding region for target Tm
check_pair, # Full primer pair compatibility report
pcr_protocol, # Generate complete PCR cycling protocol
reverse_complement, # DNA reverse complement
from_csv, to_csv, # CSV batch I/O
)
# Batch Tm for multiple primers
results = batch_tm(["ATCGATCGATCG", "GCGCGCGCGCGC", "AATTCCGGAATT"])
for r in results:
print(f"{r['sequence']}: Tm={r['tm']} degC, GC={r['gc_pct']}%")
# Find optimal binding length for a target Tm
result = optimal_binding_length("ATGTCCCTGCTCTTCTCTCGATGCAA", target_tm=65)
print(f"{result['binding_seq']} ({result['length']} nt, Tm={result['tm']})")
# CCTGCTCTTCTCTCGATGCAA (21 nt, Tm=67)
# Primer pair compatibility check (includes auto additive recommendation)
pair = check_pair("ATGTCCCTGCTCTTCTCTCGATGCAA", "GTGCCTCCGAGCCAGCACC")
print(f"Ta={pair['ta']}, compatible={pair['compatible']}")
if pair["additive"]["recommended"]:
print(f"Use {pair['additive']['additive']} ({pair['additive']['concentration']})")
# -> "Use Q5 High GC Enhancer (1x)" for Q5 with high-GC primers
# -> "Use DMSO (3%)" for Taq with high-GC primers
# Generate full PCR cycling protocol
protocol = pcr_protocol(
"ATGTCCCTGCTCTTCTCTCGATGCAA",
"GTGCCTCCGAGCCAGCACC",
template="...full template sequence...", # Auto-calculates amplicon_length
)
for step in protocol["cycling"]:
print(f"{step['step']:25s} {step['temp']} degC {step['time']}")
# Initial Denaturation 98 degC 30 s
# Denaturation 98 degC 10 s
# Annealing 72 degC 30 s
# Extension 72 degC 1 min 15 s
# Final Extension 72 degC 2 min
# Hold 4 degC indefinite
# CSV pipeline: read primers, compute everything, write results
results = from_csv("primers.csv") # expects columns: name, fwd, rev
to_csv(results, "results_with_tm.csv")
Site-Directed Mutagenesis (NEB Base Changer)
from polymerase_tm import BaseChanger
# Design SDM primers for a point mutation
template = "ATGACCATGATTACGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGG..."
bc = BaseChanger(template)
result = bc.point_mutation("T2A")
print(f"FWD: {result.forward.sequence} (Tm={result.forward.tm})")
print(f"REV: {result.reverse.sequence} (Tm={result.reverse.tm})")
print(f"Ta: {result.ta} degC")
# Multiple mutations
results = bc.batch("T2A A3G K5R")
# Deletion / insertion
result = bc.deletion(start=10, length=3)
result = bc.insertion(position=10, insert_seq="AAAAAA")
# Parsimony codon selection (fewest base changes)
bc = BaseChanger(template, codon_mode="parsimony")
# Alternative genetic code (e.g. vertebrate mitochondrial)
bc = BaseChanger(template, genetic_code=2)
DMSO Analysis
from polymerase_tm import dmso_recommendation, print_dmso_report
report = dmso_recommendation(
fwd_bind="ATGTCCCTGCTCTTCTCTCGATGCAA",
rev_bind="GTGCCTCCGAGCCAGCACC",
template_file="template.gbk", # optional GenBank template
)
print_dmso_report(report)
Command Line
# Single primer Tm
polymerase-tm ATGTCCCTGCTCTTCTCTCGATGCAA
# Primer pair Ta (includes auto additive recommendation)
polymerase-tm ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC
# Different polymerase
polymerase-tm -p taq ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC
# Override buffer (e.g. when not using master mix)
polymerase-tm --buffer thermopol ATGTCCCTGCTCTTCTCTCGATGCAA
# Direct salt concentration override
polymerase-tm --salt 50 ATGTCCCTGCTCTTCTCTCGATGCAA
# With DMSO correction
polymerase-tm --dmso 3 ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC
# DMSO analysis with template
polymerase-tm --dmso-check --template plasmid.gbk FWD_SEQ REV_SEQ
# Generate PCR Cycler Protocol & Virtual Agarose Gel Plot
polymerase-tm ATGTCCCTGCTCTTCTCTCGATGCAA GTGCCTCCGAGCCAGCACC --template plasmid.gbk --plot-gel out_gel.png
# Generate a standalone virtual gel with multiple custom fragments and a 100bp ladder
polymerase-tm --plot-gel out_multi.png --ladder 100bp --plot-gel-sizes 150 200 400
# Simulate a custom gel run (e.g. 1.5% agarose, 110V, 90 minutes, 15cm gel)
polymerase-tm --plot-gel custom_physics.png --ladder 1kb_plus --plot-gel-sizes 1500 3000 --agarose 1.5 --voltage 110 --time 90 --gel-length 15.0
# Compare topological isomers of the same size plasmid (Linear vs Supercoiled vs Nicked)
polymerase-tm --plot-gel topologies.png --plot-gel-sizes 3000 3000 3000 --topology linear coiled nicked
# List all polymerases / buffers
polymerase-tm --list
polymerase-tm --list-buffers
# Version
polymerase-tm --version
# Site-directed mutagenesis (NEB Base Changer)
polymerase-tm --sdm --mutation M1A TEMPLATE_SEQ
polymerase-tm --sdm --mutation "T2A K5R" --codon-mode parsimony TEMPLATE_SEQ
polymerase-tm --sdm --mode del --mutation 10:3 TEMPLATE_SEQ
polymerase-tm --sdm --mode ins --mutation 10:AAAAAA TEMPLATE_SEQ
polymerase-tm --sdm --mutation T2A --genetic-code 2 TEMPLATE_SEQ
API Reference
| Function | Description |
|---|---|
tm(seq, polymerase, buffer, salt_mM) |
Melting temperature for one primer |
ta(seq1, seq2, polymerase, dmso_pct, buffer, salt_mM) |
Annealing temperature for a primer pair |
list_polymerases() |
List all 22 supported polymerases |
list_buffers() |
List all 17 NEB buffers with salt concentrations |
batch_tm(sequences, polymerase) |
Batch Tm for multiple sequences |
check_pair(fwd, rev, polymerase) |
Pair compatibility + additive recommendation |
pcr_protocol(fwd, rev, polymerase, template, amplicon_length) |
Full PCR cycling protocol (auto-touchdown when Tm diff > 3 degC) |
optimal_binding_length(seq, target_tm, polymerase) |
Find shortest binding region for target Tm |
reverse_complement(seq) |
DNA reverse complement |
from_csv(path, polymerase) |
Read primer pairs from CSV, compute Tm/Ta |
to_csv(results, path) |
Write results to CSV |
primer_dimer(fwd, rev) |
Check 3' complementarity / dimer risk |
gibson_overlaps(fwd_bind, rev_bind, left_seq, right_seq) |
Design Gibson/HiFi Assembly primers |
restriction_scan(seq, enzymes) |
Scan for restriction sites (~120 NEB enzymes, IUPAC support, accepts name list or dict) |
primer_quality(seq) |
Quality score 0-100 with issues list |
find_hairpins(seq) |
Detect hairpin stem-loops with NN Tm |
primer_hairpin(seq) |
Hairpin scan tuned for primer-length sequences |
additive_recommendation(fwd, rev, polymerase) |
DMSO / GC Enhancer recommendation |
dmso_recommendation(fwd_bind, rev_bind, template_seq, template_file) |
Full DMSO/additive analysis |
print_dmso_report(report) |
Pretty-print a DMSO analysis report |
gc_content(seq) |
GC content as fraction |
plot_virtual_gel(amplicon_lengths, ladder_name, agarose_pct, ...) |
Simulated agarose gel image (requires [viz]) |
BaseChanger(template, orf_start, genetic_code, codon_mode, ...) |
SDM primer designer (NEB Base Changer v2.7.2) |
select_codon(target_aa, original_codon, mode, genetic_code) |
Codon selection (usage/parsimony) |
parse_aa_mutation(mutation_str) |
Parse AA mutation notation ("M1A", "K2R:CGC") |
calc_sdm_tm(seq, mono_mM, divalent_mM, primer_conc_nM) |
SDM Tm with bivariate salt correction |
owczarzy_bivariate(raw_tm, seq, mono_mM, divalent_mM) |
Owczarzy (2008) Na+/Mg2+ correction |
GENETIC_CODES |
All 12 NCBI genetic codes |
get_codon_table(code_id) |
Full codon table for any genetic code |
get_aa_to_codons(code_id) |
Amino acid → codons for any genetic code |
Buffer / salt override:
tm()andta()accept optionalbuffer(NEB buffer name) orsalt_mM(direct mM value) to override the polymerase default. Priority:salt_mM>buffer> polymerase default.
Algorithm
| Component | Method | Reference |
|---|---|---|
| Nearest-neighbor Tm | SantaLucia (1998) | PNAS 95:1460-5 |
| Salt correction (mono) | Owczarzy et al. (2004) | Biochemistry 43:3537-54 |
| Salt correction (bivariate) | Owczarzy et al. (2008) | Biochemistry 47:5336-53 |
| Ta rules | Polymerase-specific | NEB Tm Calculator v1.16 |
| SDM primer design | Back-to-back | NEB Base Changer v2.7.2 |
| DMSO correction | -0.6 degC per 1% | NEB Tm Calculator v1.16 |
Buffer Salt Concentrations
| Buffer | [Monovalent] (mM) | Used by |
|---|---|---|
| Q5 | 150 | Q5, Q5 Hot Start, Q5 Blood Direct |
| Q5U | 170 | Q5U Hot Start |
| Q5 Master Mix | 150 | Q5 2X Master Mix |
| Phusion HF / GC | 222 | Phusion, Phusion Hot Start Flex |
| Standard Taq | 55 | Taq, Hot Start Taq, EpiMark |
| ThermoPol | 40 | Vent, Deep Vent |
| OneTaq Std | 54 | OneTaq (Standard Buffer) |
| OneTaq GC | 80 | OneTaq (GC Buffer) |
| LongAmp | 100 | LongAmp, LongAmp Hot Start |
| Crimson Taq | 55 | Crimson Taq |
| Hemo KlenTaq | 70 | Hemo KlenTaq |
| Multiplex | 90 | Multiplex PCR Master Mix |
Ta Calculation Rules
| Polymerase family | Rule | Cap |
|---|---|---|
| Q5 | min(Tm1, Tm2) + 1 | 72 degC |
| Q5U | min(Tm1, Tm2) + 2 | 72 degC |
| Phusion | 0.93 * min(Tm1, Tm2) + 7.5 | 72 degC |
| Taq / OneTaq | min(Tm1, Tm2) - 5 | 68 degC |
| LongAmp | min(Tm1, Tm2) - 5 | 65 degC |
| Vent / Deep Vent | min(Tm1, Tm2) - 2 | 72 degC |
Disclaimer
This package is not affiliated with New England Biolabs (NEB). The algorithms were reverse-engineered from the publicly available JavaScript sources of the NEB Tm Calculator and NEB Base Changer for research and educational purposes. Always verify critical calculations against the official tools.
Module Structure
polymerase_tm/
├── __init__.py # Re-exports (backward compatible)
├── constants.py # NN_PARAMS, BUFFERS, POLYMERASES, GENETIC_CODES
├── core.py # tm(), ta(), owczarzy_bivariate(), calc_sdm_tm()
├── mutagenesis.py # BaseChanger, SDMPrimer, MutagenesisResult
├── dmso.py # DMSO analysis, hairpins, GC analysis
├── batch.py # batch_tm(), pcr_protocol(), CSV I/O
├── analysis.py # restriction_scan(), primer_dimer(), primer_quality()
├── gel.py # Virtual agarose gel visualization
└── cli.py # Command-line interface (Tm/Ta + SDM)
All functions are re-exported from __init__.py — from polymerase_tm import tm and from polymerase_tm import BaseChanger work directly.
License
MIT
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file polymerase_tm-2.0.0.tar.gz.
File metadata
- Download URL: polymerase_tm-2.0.0.tar.gz
- Upload date:
- Size: 64.0 kB
- Tags: Source
- Uploaded using Trusted Publishing? Yes
- Uploaded via: twine/6.1.0 CPython/3.13.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
a851cb1de97f5f697fca6e4e98813823bf5fd11c235cbeea05234c7bd257b3fd
|
|
| MD5 |
797be10a1434b0b679b89b04cbdf8cc4
|
|
| BLAKE2b-256 |
466ea5bb3296be9a8d009c2e5c8928a46c99628347e4a0b8451e2da1cda8a8ae
|
File details
Details for the file polymerase_tm-2.0.0-py3-none-any.whl.
File metadata
- Download URL: polymerase_tm-2.0.0-py3-none-any.whl
- Upload date:
- Size: 53.2 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? Yes
- Uploaded via: twine/6.1.0 CPython/3.13.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
75c564a84226e69c27c80bb226e1b5f93d27ceb2865ab45668982490dc7b28af
|
|
| MD5 |
8235a12b24a9241ea99e809da06413bf
|
|
| BLAKE2b-256 |
767cab349917dcdce01dd43e6dd58be5d221b12d160165fa68cc602ff429dfca
|