Format-agnostic parser for Illumina SampleSheet.csv files — supports IEM V1 and BCLConvert V2
Project description
samplesheet-parser
Format-agnostic Python parser for Illumina SampleSheet.csv files.
Supports IEM V1 (bcl2fastq / NovaSeq 6000 era) and BCLConvert V2 (NovaSeq X series) with automatic format detection, index validation, and OverrideCycles / UMI decoding — no format hints required from the caller.
The problem
Labs running mixed instrument fleets — NovaSeq 6000 alongside NovaSeq X series — produce two structurally incompatible SampleSheet.csv formats:
| IEM V1 | BCLConvert V2 | |
|---|---|---|
| Discriminator | IEMFileVersion in [Header] |
FileFormatVersion in [Header] |
| Data section | [Data] |
[BCLConvert_Data] |
| Settings section | [Settings] |
[BCLConvert_Settings] |
| Index columns | index, index2 (lowercase) |
Index, Index2 (uppercase) |
| Read cycles | Bare integers | Key-value (Read1Cycles,151) |
| UMI encoding | Not supported | OverrideCycles string |
| Used with | bcl2fastq | BCLConvert ≥ 3.x |
Without a single parser, every pipeline component that reads a SampleSheet needs an if v1 else v2 branch — or worse, the format is hardcoded and the wrong sheet is silently processed.
Installation
pip install samplesheet-parser
Requires Python 3.10+. The only mandatory dependency is loguru.
Quickstart
Auto-detect format (recommended)
from samplesheet_parser import SampleSheetFactory
factory = SampleSheetFactory()
sheet = factory.create_parser("SampleSheet.csv", parse=True)
print(factory.version) # SampleSheetVersion.V1 or .V2
print(sheet.index_type()) # "dual", "single", or "none"
print(factory.get_umi_length()) # 0 if no UMI
for sample in sheet.samples():
print(sample["sample_id"], sample["index"])
Validate before demultiplexing
from samplesheet_parser import SampleSheetFactory, SampleSheetValidator
sheet = SampleSheetFactory().create_parser("SampleSheet.csv", parse=True)
result = SampleSheetValidator().validate(sheet)
print(result.summary())
# PASS — 0 error(s), 1 warning(s)
for err in result.errors:
print(err)
# [ERROR] DUPLICATE_INDEX: Index 'ATTACTCG+TATAGCCT' appears more than once in lane 1.
UMI extraction (V2 only)
from samplesheet_parser import SampleSheetV2
sheet = SampleSheetV2("SampleSheet.csv", parse=True)
# OverrideCycles: Y151;I10U9;I10;Y151 → 9 bp UMI in Index1
print(sheet.get_umi_length()) # 9
rs = sheet.get_read_structure()
print(rs.umi_location) # "index2"
print(rs.read_structure) # {"read1_template": 151, "index2_length": 10, "index2_umi": 9, ...}
Use parsers directly
from samplesheet_parser import SampleSheetV1, SampleSheetV2
# V1
v1 = SampleSheetV1("SampleSheet_v1.csv", parse=True)
print(v1.experiment_name) # "240115_A01234_0042_AHJLG7DRXX"
print(v1.instrument_type) # "NovaSeq 6000"
print(v1.adapter_read1) # "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"
print(v1.adapter_read2) # "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"
print(v1.reverse_complement) # 0
print(v1.read_lengths) # [151, 151]
# V2
v2 = SampleSheetV2("SampleSheet_v2.csv", parse=True)
print(v2.instrument_platform) # "NovaSeqXSeries"
print(v2.software_version) # "3.9.3"
Format detection logic
The factory uses a three-step strategy — stopping as early as possible:
1. Scan [Header] for FileFormatVersion → V2
or IEMFileVersion → V1
2. If undetermined: scan full file for
[BCLConvert_Settings] or
[BCLConvert_Data] → V2
3. Default → V1
The file is read only once. No second open(), no seek().
OverrideCycles decoding
The V2 OverrideCycles string encodes the full read structure using single-letter type codes:
| Code | Meaning |
|---|---|
Y |
Template (sequenced) bases |
I |
Index bases |
U |
UMI bases |
N |
Masked / skipped bases |
Segment order: Read1 ; Index1 ; Index2 ; Read2
| OverrideCycles | UMI length | UMI location |
|---|---|---|
Y151;I10;I10;Y151 |
0 | — |
Y151;I10U9;I10;Y151 |
9 bp | Index1 |
U5Y146;I8;I8;U5Y146 |
5 bp | Read1 + Read2 |
Y76;I8;Y76 |
0 | — (single-index) |
Validation checks
| Code | Level | Condition |
|---|---|---|
EMPTY_SAMPLES |
error | No samples found in data section |
INVALID_INDEX_CHARS |
error | Index contains non-ACGTN characters |
INDEX_TOO_LONG |
error | Index longer than 24 bp |
DUPLICATE_INDEX |
error | Two samples share an index in the same lane |
DUPLICATE_SAMPLE_ID |
error | Same Sample_ID appears twice in one lane |
INDEX_TOO_SHORT |
warning | Index shorter than 6 bp |
NO_ADAPTERS |
warning | No adapter sequences configured |
ADAPTER_MISMATCH |
warning | Adapter is not a standard Illumina sequence |
API reference
SampleSheetFactory
factory = SampleSheetFactory()
sheet = factory.create_parser(path, *, clean=True, experiment_id=None, parse=None)
| Attribute / Method | Returns | Description |
|---|---|---|
.create_parser(path, ...) |
SampleSheetV1 | SampleSheetV2 |
Auto-detect format and return parser |
.get_umi_length() |
int |
UMI length from current parser |
.version |
SampleSheetVersion |
Detected version after create_parser() |
Shared interface — SampleSheetV1 and SampleSheetV2
| Method / Attribute | Returns | Description |
|---|---|---|
.parse(do_clean=True) |
None |
Parse all sections |
.samples() |
list[dict] |
One record per unique sample |
.index_type() |
str |
"dual", "single", or "none" |
.adapters |
list[str] |
All configured adapter sequences |
.experiment_name |
str | None |
Run or experiment name |
.read_lengths / .reads |
list[int] / dict |
Read cycle lengths |
V1-specific
| Attribute | Type | Description |
|---|---|---|
.iem_version |
str | None |
e.g. "5" |
.instrument_type |
str | None |
e.g. "NovaSeq 6000", "MiSeq" |
.application |
str | None |
e.g. "FASTQ Only" |
.assay |
str | None |
Library prep kit name |
.index_adapters |
str | None |
Illumina index set name |
.chemistry |
str | None |
"Amplicon" = dual index, "Default" = single/no index |
.adapter_read1 |
str |
Read 1 adapter (Adapter or AdapterRead1 key) |
.adapter_read2 |
str |
Read 2 adapter (AdapterRead2 key) |
.reverse_complement |
int |
0 = default, 1 = reverse-complement R2 (Nextera MP only) |
.flowcell_id |
str | None |
Parsed from experiment ID run folder name |
V2-specific
| Method / Attribute | Returns | Description |
|---|---|---|
.get_umi_length() |
int |
UMI length from OverrideCycles |
.get_read_structure() |
ReadStructure |
Full decoded read structure |
.instrument_platform |
str | None |
e.g. "NovaSeqXSeries" |
.software_version |
str | None |
BCLConvert version string |
.custom_fields |
dict[str, set[str]] |
Non-standard fields by section |
Example sample sheets
The examples/sample_sheets/ directory contains ready-to-use reference sheets for every supported configuration:
| File | Format | Instrument | UMI | Use case |
|---|---|---|---|---|
v1_dual_index.csv |
V1 | NovaSeq 6000 | No | Standard WGS, multi-lane |
v1_single_index.csv |
V1 | NextSeq 500 | No | Small RNA |
v1_multi_lane.csv |
V1 | NovaSeq 6000 | No | 4 lanes, mixed projects |
v2_novaseq_x_dual_index.csv |
V2 | NovaSeq X | No | Standard PE150 |
v2_with_index_umi.csv |
V2 | NovaSeq X | Index1 UMI (9 bp) | cfDNA / liquid biopsy |
v2_with_read_umi.csv |
V2 | NovaSeq X | Read UMI (5 bp) | Duplex sequencing |
v2_nextseq_single_index.csv |
V2 | NextSeq 1000/2000 | No | Amplicon panel |
Run the demo to parse all of them:
python examples/parse_examples.py
V1 adapter key reference
From the Illumina IEM specification, the correct V1 [Settings] adapter keys are:
[Settings]
ReverseComplement,0
Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Adapter= Read 1 adapter (primary key per IEM spec)AdapterRead2= Read 2 adapter (explicit separate key)AdapterRead1= BCLConvert V1-mode alias forAdapter(also accepted)ReverseComplement,1= only for Nextera Mate Pair libraries;0for everything else
Project structure
samplesheet-parser/
├── samplesheet_parser/
│ ├── __init__.py # Public API
│ ├── factory.py # SampleSheetFactory — auto-detection
│ ├── enums.py # SampleSheetVersion, IndexType, ...
│ ├── validators.py # SampleSheetValidator, ValidationResult
│ └── parsers/
│ ├── v1.py # IEM V1 parser (bcl2fastq)
│ └── v2.py # BCLConvert V2 parser (NovaSeq X)
├── tests/
│ ├── conftest.py # Shared fixtures
│ ├── test_factory.py
│ ├── test_parsers/
│ │ ├── test_v1.py
│ │ └── test_v2.py
│ └── test_validators/
│ └── test_validators.py
├── examples/
│ ├── parse_examples.py # Demo script
│ └── sample_sheets/ # Reference SampleSheet.csv files
├── pyproject.toml
├── LICENSE
└── README.md
Development
git clone https://github.com/chaitanyakasaraneni/samplesheet-parser
cd samplesheet-parser
pip install -e ".[dev]"
# Run tests
pytest tests/ -v
# Run example demo
python examples/parse_examples.py
Citation
If you use this library in a published pipeline or analysis, please cite:
@software{kasaraneni2026samplsheetparser,
author = {Kasaraneni, Chaitanya},
title = {samplesheet-parser: Format-agnostic parser for Illumina SampleSheet.csv},
year = {2026},
url = {https://github.com/chaitanyakasaraneni/samplesheet-parser},
version = {0.1.4}
}
License
Apache 2.0 — see LICENSE.
Related resources
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file samplesheet_parser-0.1.5.tar.gz.
File metadata
- Download URL: samplesheet_parser-0.1.5.tar.gz
- Upload date:
- Size: 30.0 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.1.0 CPython/3.13.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
b2079e6d26a8810896b468268f54edf34322dd649f4dcbc0c0883f52d35c12d9
|
|
| MD5 |
70151d57a726275fe5f8921fc0a81e59
|
|
| BLAKE2b-256 |
6f0072edb26d674b7cb8d2f3b97aa941424d280d4b82158cd2b731ab16c2c9ef
|
File details
Details for the file samplesheet_parser-0.1.5-py3-none-any.whl.
File metadata
- Download URL: samplesheet_parser-0.1.5-py3-none-any.whl
- Upload date:
- Size: 26.1 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: twine/6.1.0 CPython/3.13.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
fa4292832467578ea7f053cded554fec52f8cb72793fbe876284fb2be5d00689
|
|
| MD5 |
e8c88e29e080ef729eaf8faf33b340c4
|
|
| BLAKE2b-256 |
b60c01f55a9311a4d5ca7c23be149db0e801fb7e8a0334be3c4e1496ba2b1aad
|