samplesheet-parser 0.1.5

Format-agnostic parser for Illumina SampleSheet.csv files — supports IEM V1 and BCLConvert V2

samplesheet-parser

Format-agnostic Python parser for Illumina SampleSheet.csv files.

Supports IEM V1 (bcl2fastq / NovaSeq 6000 era) and BCLConvert V2 (NovaSeq X series) with automatic format detection, index validation, and OverrideCycles / UMI decoding — no format hints required from the caller.

---

The problem

Labs running mixed instrument fleets — NovaSeq 6000 alongside NovaSeq X series — produce two structurally incompatible SampleSheet.csv formats:

	IEM V1	BCLConvert V2
Discriminator	IEMFileVersion in [Header]	FileFormatVersion in [Header]
Data section	[Data]	[BCLConvert_Data]
Settings section	[Settings]	[BCLConvert_Settings]
Index columns	index, index2 (lowercase)	Index, Index2 (uppercase)
Read cycles	Bare integers	Key-value (Read1Cycles,151)
UMI encoding	Not supported	OverrideCycles string
Used with	bcl2fastq	BCLConvert ≥ 3.x

Without a single parser, every pipeline component that reads a SampleSheet needs an if v1 else v2 branch — or worse, the format is hardcoded and the wrong sheet is silently processed.

---

Installation

pip install samplesheet-parser

Requires Python 3.10+. The only mandatory dependency is loguru.

---

Quickstart

Auto-detect format (recommended)

from samplesheet_parser import SampleSheetFactory

factory = SampleSheetFactory()
sheet = factory.create_parser("SampleSheet.csv", parse=True)

print(factory.version)           # SampleSheetVersion.V1 or .V2
print(sheet.index_type())        # "dual", "single", or "none"
print(factory.get_umi_length())  # 0 if no UMI

for sample in sheet.samples():
    print(sample["sample_id"], sample["index"])

Validate before demultiplexing

from samplesheet_parser import SampleSheetFactory, SampleSheetValidator

sheet = SampleSheetFactory().create_parser("SampleSheet.csv", parse=True)
result = SampleSheetValidator().validate(sheet)

print(result.summary())
# PASS — 0 error(s), 1 warning(s)

for err in result.errors:
    print(err)
# [ERROR] DUPLICATE_INDEX: Index 'ATTACTCG+TATAGCCT' appears more than once in lane 1.

UMI extraction (V2 only)

from samplesheet_parser import SampleSheetV2

sheet = SampleSheetV2("SampleSheet.csv", parse=True)

# OverrideCycles: Y151;I10U9;I10;Y151 → 9 bp UMI in Index1
print(sheet.get_umi_length())        # 9
rs = sheet.get_read_structure()
print(rs.umi_location)               # "index2"
print(rs.read_structure)             # {"read1_template": 151, "index2_length": 10, "index2_umi": 9, ...}

Use parsers directly

from samplesheet_parser import SampleSheetV1, SampleSheetV2

# V1
v1 = SampleSheetV1("SampleSheet_v1.csv", parse=True)
print(v1.experiment_name)    # "240115_A01234_0042_AHJLG7DRXX"
print(v1.instrument_type)    # "NovaSeq 6000"
print(v1.adapter_read1)      # "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"
print(v1.adapter_read2)      # "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"
print(v1.reverse_complement) # 0
print(v1.read_lengths)       # [151, 151]

# V2
v2 = SampleSheetV2("SampleSheet_v2.csv", parse=True)
print(v2.instrument_platform)  # "NovaSeqXSeries"
print(v2.software_version)     # "3.9.3"

---

Format detection logic

The factory uses a three-step strategy — stopping as early as possible:

1. Scan [Header] for FileFormatVersion  → V2
                  or IEMFileVersion     → V1

2. If undetermined: scan full file for
   [BCLConvert_Settings] or
   [BCLConvert_Data]                    → V2

3. Default                              → V1

The file is read only once. No second open(), no seek().

---

OverrideCycles decoding

The V2 OverrideCycles string encodes the full read structure using single-letter type codes:

Code	Meaning
Y	Template (sequenced) bases
I	Index bases
U	UMI bases
N	Masked / skipped bases

Segment order: Read1 ; Index1 ; Index2 ; Read2

OverrideCycles	UMI length	UMI location
Y151;I10;I10;Y151	0	—
Y151;I10U9;I10;Y151	9 bp	Index1
U5Y146;I8;I8;U5Y146	5 bp	Read1 + Read2
Y76;I8;Y76	0	— (single-index)

---

Validation checks

Code	Level	Condition
EMPTY_SAMPLES	error	No samples found in data section
INVALID_INDEX_CHARS	error	Index contains non-ACGTN characters
INDEX_TOO_LONG	error	Index longer than 24 bp
DUPLICATE_INDEX	error	Two samples share an index in the same lane
DUPLICATE_SAMPLE_ID	error	Same Sample_ID appears twice in one lane
INDEX_TOO_SHORT	warning	Index shorter than 6 bp
NO_ADAPTERS	warning	No adapter sequences configured
ADAPTER_MISMATCH	warning	Adapter is not a standard Illumina sequence

---

API reference

SampleSheetFactory

factory = SampleSheetFactory()
sheet = factory.create_parser(path, *, clean=True, experiment_id=None, parse=None)

Attribute / Method	Returns	Description
.create_parser(path, ...)	SampleSheetV1 | SampleSheetV2	Auto-detect format and return parser
.get_umi_length()	int	UMI length from current parser
.version	SampleSheetVersion	Detected version after create_parser()

Shared interface — SampleSheetV1 and SampleSheetV2

Method / Attribute	Returns	Description
.parse(do_clean=True)	None	Parse all sections
.samples()	list[dict]	One record per unique sample
.index_type()	str	"dual", "single", or "none"
.adapters	list[str]	All configured adapter sequences
.experiment_name	str | None	Run or experiment name
.read_lengths / .reads	list[int] / dict	Read cycle lengths

V1-specific

Attribute	Type	Description
.iem_version	str | None	e.g. "5"
.instrument_type	str | None	e.g. "NovaSeq 6000", "MiSeq"
.application	str | None	e.g. "FASTQ Only"
.assay	str | None	Library prep kit name
.index_adapters	str | None	Illumina index set name
.chemistry	str | None	"Amplicon" = dual index, "Default" = single/no index
.adapter_read1	str	Read 1 adapter (Adapter or AdapterRead1 key)
.adapter_read2	str	Read 2 adapter (AdapterRead2 key)
.reverse_complement	int	0 = default, 1 = reverse-complement R2 (Nextera MP only)
.flowcell_id	str | None	Parsed from experiment ID run folder name

V2-specific

Method / Attribute	Returns	Description
.get_umi_length()	int	UMI length from OverrideCycles
.get_read_structure()	ReadStructure	Full decoded read structure
.instrument_platform	str | None	e.g. "NovaSeqXSeries"
.software_version	str | None	BCLConvert version string
.custom_fields	dict[str, set[str]]	Non-standard fields by section

---

Example sample sheets

The examples/sample_sheets/ directory contains ready-to-use reference sheets for every supported configuration:

File	Format	Instrument	UMI	Use case
v1_dual_index.csv	V1	NovaSeq 6000	No	Standard WGS, multi-lane
v1_single_index.csv	V1	NextSeq 500	No	Small RNA
v1_multi_lane.csv	V1	NovaSeq 6000	No	4 lanes, mixed projects
v2_novaseq_x_dual_index.csv	V2	NovaSeq X	No	Standard PE150
v2_with_index_umi.csv	V2	NovaSeq X	Index1 UMI (9 bp)	cfDNA / liquid biopsy
v2_with_read_umi.csv	V2	NovaSeq X	Read UMI (5 bp)	Duplex sequencing
v2_nextseq_single_index.csv	V2	NextSeq 1000/2000	No	Amplicon panel

Run the demo to parse all of them:

python examples/parse_examples.py

---

V1 adapter key reference

From the Illumina IEM specification, the correct V1 [Settings] adapter keys are:

[Settings]
ReverseComplement,0
Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

• Adapter = Read 1 adapter (primary key per IEM spec)
• AdapterRead2 = Read 2 adapter (explicit separate key)
• AdapterRead1 = BCLConvert V1-mode alias for Adapter (also accepted)
• ReverseComplement,1 = only for Nextera Mate Pair libraries; 0 for everything else

---

Project structure

samplesheet-parser/
├── samplesheet_parser/
│   ├── __init__.py          # Public API
│   ├── factory.py           # SampleSheetFactory — auto-detection
│   ├── enums.py             # SampleSheetVersion, IndexType, ...
│   ├── validators.py        # SampleSheetValidator, ValidationResult
│   └── parsers/
│       ├── v1.py            # IEM V1 parser (bcl2fastq)
│       └── v2.py            # BCLConvert V2 parser (NovaSeq X)
├── tests/
│   ├── conftest.py          # Shared fixtures
│   ├── test_factory.py
│   ├── test_parsers/
│   │   ├── test_v1.py
│   │   └── test_v2.py
│   └── test_validators/
│       └── test_validators.py
├── examples/
│   ├── parse_examples.py    # Demo script
│   └── sample_sheets/       # Reference SampleSheet.csv files
├── pyproject.toml
├── LICENSE
└── README.md

---

Development

git clone https://github.com/chaitanyakasaraneni/samplesheet-parser
cd samplesheet-parser
pip install -e ".[dev]"

# Run tests
pytest tests/ -v

# Run example demo
python examples/parse_examples.py

---

Citation

If you use this library in a published pipeline or analysis, please cite:

@software{kasaraneni2026samplsheetparser,
  author  = {Kasaraneni, Chaitanya},
  title   = {samplesheet-parser: Format-agnostic parser for Illumina SampleSheet.csv},
  year    = {2026},
  url     = {https://github.com/chaitanyakasaraneni/samplesheet-parser},
  version = {0.1.4}
}

---

License

Apache 2.0 — see LICENSE.

---

Related resources

• Illumina IEM V1 SampleSheet reference (Knowledge Article #2204)
• BCLConvert Software Guide
• Upgrading from bcl2fastq to BCLConvert