Skip to main content

Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.

Project description


Travis-CI Build Status Requirements Status Coverage Status
Code issues


PyPI Package latest release PyPI Wheel Supported versions Supported implementations

Another SeqRecord class with methods: degenerate seqs, codon positions based on reading frames, etc.


By default it assumes a DNA sequence with ambiguous characters.

>>> from seqrecord_expanded import SeqRecordExpanded
>>> seq_record = SeqRecordExpanded('TCTGAATGGAAGACAAAGCGTCCA',
...                                voucher_code='CP100-09',
...                                taxonomy={'genus': 'Melitaea',
...                                          'species': 'phoebe',
...                                         },
...                                gene_code='EF1a',
...                                reading_frame=1,
...                                table=1,  # translation table
...                                )
>>> # Degenerate sequence standard genetic code
>>> seq_record.degenerate()
>>> # Degenerate sequence S method
>>> seq_record.degenerate(method='S')
>>> # Degenerate sequence Z method
>>> seq_record.degenerate(method='Z')
>>> # Degenerate sequence SZ method
>>> seq_record.degenerate(method='SZ')
>>> # get first codon positions
>>> seq_record.first_codon_position()
>>> # get second codon positions
>>> seq_record.second_codon_position()
>>> # get third codon positions
>>> seq_record.third_codon_position()
>>> # get first and second positions
>>> seq_record.first_and_second_positions()
>>> # translate to aminoacid sequence
>>> seq_record.translate()
>>> # translate to aminoacid sequence
>>> seq_record.translate(table=1)


pip install seqrecord-expanded


pip install -r requirements.txt


Supported Python versions: 2.6, 2.7, 3.3, 3.4, 3.5, pypy.




seqrecord-expanded was written by Carlos Peña.

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

seqrecord_expanded-0.2.12.tar.gz (5.2 kB view hashes)

Uploaded source

Supported by

AWS AWS Cloud computing Datadog Datadog Monitoring Facebook / Instagram Facebook / Instagram PSF Sponsor Fastly Fastly CDN Google Google Object Storage and Download Analytics Huawei Huawei PSF Sponsor Microsoft Microsoft PSF Sponsor NVIDIA NVIDIA PSF Sponsor Pingdom Pingdom Monitoring Salesforce Salesforce PSF Sponsor Sentry Sentry Error logging StatusPage StatusPage Status page