Streamlit SeqViz

Streamlit SeqViz 🧬 brings the powerful SeqViz DNA/RNA/protein viewer to Streamlit. It allows you to visualize and explore biological sequences interactively inside your Streamlit apps with support for annotations, primers, restriction sites, translations, and more.

Demo

SeqViz demo

Installation

pip install st-seqviz

Usage

import streamlit as st

from st_seqviz import SeqViz

sv = SeqViz(
    seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
    name="J23100",
    annotations=[
        {"name": "promoter", "start": 0, "end": 34, "direction": 1, "color": "blue"}
    ],
)

st.json(sv)

➡️ See the /demo folder for more complex examples (annotations, enzymes, translations, highlights, etc.).

API Reference

Parameters

Name	Type	Default	Description
`seq`	`str`	—	DNA, RNA, or amino acid sequence to render.
`viewer`	`"linear"`, `"circular"`, `"both"`, `"both_flip"`	`"both"`	Viewer layout and orientation.
`name`	`str`	`""`	Name of the sequence or plasmid.
`annotations`	`list[dict]`	`[]`	Sequence annotations (`start`, `end`, `name`, `direction`).
`primers`	`list[dict]`	`[]`	Primer regions (same structure as annotations).
`translations`	`list[dict]`	`[]`	Sequence ranges to translate and display as amino acids.
`enzymes`	`list[str \| dict]`	`[]`	Restriction enzymes or custom recognition sites.
`highlights`	`list[dict]`	`[]`	Sequence ranges to visually highlight.
`zoom_linear`	`int`	`50`	Linear viewer zoom level (0–100).
`colors`	`list`	`[]`	Custom color palette.
`bp_colors`	`dict`	`{}`	Map of base pairs (A/T/G/C or index) to colors.
`style`	`dict`	`{"height": "70vh", "width": "100%"}`	Custom CSS sizing and layout.
`search`	`dict`	`{}`	Predefined search query.
`show_complement`	`bool`	`True`	Display complement strand.
`rotate_on_scroll`	`bool`	`True`	Enable circular rotation on scroll.
`disable_external_fonts`	`bool`	`False`	Disable loading of external fonts.
`show_index`	`bool`	`True`	Show sequence index ticks.
`key`	`str or None`	`None`	Unique Streamlit key.

Returns

A dict containing:

selection: the current selected sequence region (if any)
search: the current search matches and metadata

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

st_seqviz-0.1.7.tar.gz (161.4 kB view details)

Uploaded Apr 27, 2026 Source

Built Distribution

If you're not sure about the file name format, learn more about wheel file names.

The dropdown lists show the available interpreters, ABIs, and platforms. Enable javascript to be able to filter the list of wheel files.

st_seqviz-0.1.7-py3-none-any.whl (161.9 kB view details)

Uploaded Apr 27, 2026 Python 3

File details

Details for the file st_seqviz-0.1.7.tar.gz.

File metadata

Download URL: st_seqviz-0.1.7.tar.gz
Upload date: Apr 27, 2026
Size: 161.4 kB
Tags: Source
Uploaded using Trusted Publishing? No
Uploaded via: twine/6.2.0 CPython/3.14.4

File hashes

Hashes for st_seqviz-0.1.7.tar.gz
Algorithm	Hash digest
SHA256	`2c0683bd8145aa1b8ec48e2974bf44180674017eb5db91a1258e1addaa50e5b8`
MD5	`6bab9937e43c321216a3775814e4b690`
BLAKE2b-256	`ab7765aa6321d1ad6e9317ebf57ae0e839c2ee2f2743d3053f96e3db0bfd5a77`

See more details on using hashes here.

File details

Details for the file st_seqviz-0.1.7-py3-none-any.whl.

File metadata

Download URL: st_seqviz-0.1.7-py3-none-any.whl
Upload date: Apr 27, 2026
Size: 161.9 kB
Tags: Python 3
Uploaded using Trusted Publishing? No
Uploaded via: twine/6.2.0 CPython/3.14.4

File hashes

Hashes for st_seqviz-0.1.7-py3-none-any.whl
Algorithm	Hash digest
SHA256	`1c3da40dd05c6ea524abb4a3c7ed3d7605e19d0ff4af86b9eb0904208cea580a`
MD5	`97580231ba9a252d85695e87aefaa9e2`
BLAKE2b-256	`3b27cea3aa0af5128a96523fe8ad623292f48217125fe0a6ab9c1ed19e56117d`