DNA, RNA, and protein sequence viewer
Project description
Streamlit SeqViz
Streamlit SeqViz 🧬 brings the powerful SeqViz DNA/RNA/protein viewer to Streamlit. It allows you to visualize and explore biological sequences interactively inside your Streamlit apps with support for annotations, primers, restriction sites, translations, and more.
Demo
Installation
pip install st-seqviz
Usage
import streamlit as st
from st_seqviz import st_seqviz
sv = SeqViz(
seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
name="J23100",
annotations=[
{"name": "promoter", "start": 0, "end": 34, "direction": 1, "color": "blue"}
],
)
st.json(sv)
➡️ See the /demo folder for more complex examples (annotations, enzymes, translations, highlights, etc.).
API Reference
Parameters
| Name | Type | Default | Description |
|---|---|---|---|
seq |
str |
— | DNA, RNA, or amino acid sequence to render. |
viewer |
"linear", "circular", "both", "both_flip" |
"both" |
Viewer layout and orientation. |
name |
str |
"" |
Name of the sequence or plasmid. |
annotations |
list[dict] |
[] |
Sequence annotations (start, end, name, direction). |
primers |
list[dict] |
[] |
Primer regions (same structure as annotations). |
translations |
list[dict] |
[] |
Sequence ranges to translate and display as amino acids. |
enzymes |
list[str | dict] |
[] |
Restriction enzymes or custom recognition sites. |
highlights |
list[dict] |
[] |
Sequence ranges to visually highlight. |
zoom_linear |
int |
50 |
Linear viewer zoom level (0–100). |
colors |
list |
[] |
Custom color palette. |
bp_colors |
dict |
{} |
Map of base pairs (A/T/G/C or index) to colors. |
style |
dict |
{"height": "70vh", "width": "100%"} |
Custom CSS sizing and layout. |
search |
dict |
{} |
Predefined search query. |
show_complement |
bool |
True |
Display complement strand. |
rotate_on_scroll |
bool |
True |
Enable circular rotation on scroll. |
disable_external_fonts |
bool |
False |
Disable loading of external fonts. |
show_index |
bool |
True |
Show sequence index ticks. |
key |
str or None |
None |
Unique Streamlit key. |
Returns
A dict containing:
selection: the current selected sequence region (if any)search: the current search matches and metadata
Project details
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file st_seqviz-0.1.0.tar.gz.
File metadata
- Download URL: st_seqviz-0.1.0.tar.gz
- Upload date:
- Size: 156.8 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
- Uploaded via: uv/0.9.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
a742247fca8d969d104456fe16d770ad471e4f0e536860c00c77c4938aa99bc7
|
|
| MD5 |
103214a1ee638b7ffdeab0ce75073203
|
|
| BLAKE2b-256 |
07d3f4901e165115d2c7de0cba21fddfc0d55ca38009bad1700f96da87a0589b
|
File details
Details for the file st_seqviz-0.1.0-py3-none-any.whl.
File metadata
- Download URL: st_seqviz-0.1.0-py3-none-any.whl
- Upload date:
- Size: 157.5 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? No
- Uploaded via: uv/0.9.7
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
38fa4700853481830b57db2b3214335a3eba74f17a6a27b08b18054eff3bd5e7
|
|
| MD5 |
78443d412221520de96ac8f505a3e5e2
|
|
| BLAKE2b-256 |
19651454961c295ac5761193059ab44023f2ba4ea7814ab83341b65df334d65f
|