st-seqviz 0.1.2

DNA, RNA, and protein sequence viewer

Streamlit SeqViz

Streamlit SeqViz 🧬 brings the powerful SeqViz DNA/RNA/protein viewer to Streamlit. It allows you to visualize and explore biological sequences interactively inside your Streamlit apps with support for annotations, primers, restriction sites, translations, and more.

Demo

Installation

pip install st-seqviz

Usage

import streamlit as st

from st_seqviz import SeqViz

sv = SeqViz(
    seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC",
    name="J23100",
    annotations=[
        {"name": "promoter", "start": 0, "end": 34, "direction": 1, "color": "blue"}
    ],
)

st.json(sv)

➡️ See the /demo folder for more complex examples (annotations, enzymes, translations, highlights, etc.).

API Reference

Parameters

Name	Type	Default	Description
seq	str	—	DNA, RNA, or amino acid sequence to render.
viewer	"linear", "circular", "both", "both_flip"	"both"	Viewer layout and orientation.
name	str	""	Name of the sequence or plasmid.
annotations	list[dict]	[]	Sequence annotations (start, end, name, direction).
primers	list[dict]	[]	Primer regions (same structure as annotations).
translations	list[dict]	[]	Sequence ranges to translate and display as amino acids.
enzymes	list[str | dict]	[]	Restriction enzymes or custom recognition sites.
highlights	list[dict]	[]	Sequence ranges to visually highlight.
zoom_linear	int	50	Linear viewer zoom level (0–100).
colors	list	[]	Custom color palette.
bp_colors	dict	{}	Map of base pairs (A/T/G/C or index) to colors.
style	dict	{"height": "70vh", "width": "100%"}	Custom CSS sizing and layout.
search	dict	{}	Predefined search query.
show_complement	bool	True	Display complement strand.
rotate_on_scroll	bool	True	Enable circular rotation on scroll.
disable_external_fonts	bool	False	Disable loading of external fonts.
show_index	bool	True	Show sequence index ticks.
key	str or None	None	Unique Streamlit key.

Returns

A dict containing:

• selection: the current selected sequence region (if any)
• search: the current search matches and metadata