vdjtools — immune-repertoire analysis

TCR/BCR immune-repertoire analysis — a clean-room Python + C++ rewrite of the legacy Groovy/Java vdjtools, standardised on the AIRR schema and polars DataFrames with minimal object-orientation.

Built on the antigenomics ecosystem: seqtree (fuzzy search / e-value engine), vdjmatch (overlap + TCRnet), arda (AIRR annotation + markup repair).

Status: stable (version: the PyPI badge above). The native V(D)J model engine plus the full analytics suite (diversity, overlap/TCRnet, preprocessing, biomarkers, single-cell), longitudinal clonotype dynamics (paired expansion testing + the VDJtrack recapture model), CDR features, and legacy-format ingestion (MiXcr, MiGec, immunoSEQ, IMGT/HighV-QUEST, Vidjil, RTCR, TRUST4, arda). Clonotype columns follow the AIRR junction convention (junction_nt / junction_aa). The legacy v1.x tool lives on the legacy-1.x branch and its releases remain available under the repository tags (v0.0.1 … 1.2.1).

Install

pip install vdjtools

Prebuilt wheels ship for CPython 3.10–3.13 on Linux, macOS (Apple Silicon), and Windows; the native _core C++ extension is bundled (the source distribution compiles it on install).

That one command gives you everything vdjtools advertises — no extras to opt into. The three antigenomics engines it delegates to are base dependencies:

So preprocess.correct(), overlap.tcrnet(), biomarker.metaclonotypes() and model.reference.load_germline() all just work from a plain install — and downstream libraries can depend on plain vdjtools and rely on them being there. All three are imported lazily, so import vdjtools stays light; between them they add only requests on top of what vdjtools already needs. arda fetches its IMGT reference once, on first use.

Two things are still optional, because each has a working alternative or is a side integration:

pip install "vdjtools[overlap]"   # scikit-learn — only for cluster_samples(method="mds");
                                  # method="hclust" works out of the box (scipy)
pip install "vdjtools[sc]"        # single-cell: anndata + awkward + mudata (scverse
                                  # bridges), pyyaml (AIRR Cell export)

MMseqs2 is needed only for arda's alignment/annotation path (model.stitch.annotate) — never for germline lookup, Pgen, generation, or the analytics. Install it via conda/brew if you need it.

Development

Uses uv — one repo-local .venv, no conda:

uv venv && source .venv/bin/activate
uv pip install -e ".[dev,test]"       # builds the _core C++ extension (scikit-build-core)

Or run the bootstrap script (portable across bash/zsh, uv-first with a python -m venv fallback):

bash setup.sh --dev-parents --tests   # or: zsh setup.sh

You need a C++ toolchain (Xcode CLT on macOS, build-essential on Linux) for the native _core extension. MMseqs2 is arda's aligner, needed only for the annotation path and the slow arda round-trip tests — brew install mmseqs2, or use the optional environment.yml conda env which bundles it.

Where to start

Quickstart

Read any format, get one canonical AIRR frame, and run the analyses the tool is for:

from vdjtools import io as vio, stats, overlap

sample = vio.read("clones.tsv")                 # MiXcr / immunoSEQ / AIRR / Parquet / native — sniffed
cohort = vio.read_samples(vio.read_metadata("metadata.txt"), base_dir="samples/")

stats.diversity.diversity_stats(sample)         # richness, Chao, Shannon, Simpson, d50
stats.usage.segment_usage(sample, segment="v")  # V / J / VJ usage
stats.spectratype.spectratype(sample)           # junction-length spectrum
overlap.overlap_matrix(cohort)                  # pairwise repertoire overlap

The same thing without Python at all:

vdjtools diversity     sampleA.tsv sampleB.tsv -o diversity.tsv
vdjtools overlap       *.tsv -o overlap.tsv
vdjtools segment-usage -m metadata.txt --base-dir samples/ -t 0 -o usage.tsv

Command line

pip install vdjtools installs the vdjtools command — the model engine (OLGA/IGoR-style) and the repertoire analytics (over sample files or a metadata table, like the legacy tool):

# recombination model engine — built-in models for all 7 loci (no download)
vdjtools models                                # list the bundled models
vdjtools generate -m TRB -n 1000 -o gen.tsv    # sample sequences   (cf. olga-generate_sequences)
vdjtools pgen seqs.tsv -m TRB -o pgen.tsv      # Pgen per CDR3       (cf. olga-compute_pgen)
vdjtools pgen seqs.tsv -m TRB --mismatches 1   # + the Hamming-1 ball; --v-col/--j-col to condition

# model workshop — a model is a directory, or LOCUS[:source[:organism]]
vdjtools model check TRB:learned                     # audit vs its germline; exits 1 on an error
vdjtools model template --locus TRB -o tmpl/         # scaffold from arda, or your own --germline-v/-j
vdjtools model learn clones.tsv -t tmpl/ -o fitted/  # EM on your sequences (--init template = fine-tune)
vdjtools model log fitted/                           # log-likelihood per iteration
vdjtools model diversity TRB:olga                    # entropy + total diversity estimate
vdjtools model compare TRB:olga TRB:learned --by gene --dot diff.pdf
vdjtools model loglik seqs.tsv TRB:learned           # log-likelihood, free parameters, AIC, BIC
vdjtools model extend fitted/ --locus TRB -o bigger/ # add a larger allele library
vdjtools model export TRB:olga --long -o marginals.tsv

# data — convert any format to the canonical table (TSV, or Parquet by extension), preprocess
vdjtools convert mixcr.txt.gz -o clones.parquet   # MiXcr/immunoSEQ/AIRR/… → canonical Parquet
vdjtools downsample clones.parquet 100000 -o ds.tsv

# filtering — THREE SEPARATE AXES, deliberately separate flags:
#   --productive       the REARRANGEMENT encodes a chain   (AIRR: in frame, no stop codon)
#   --functional-genes the GERMLINE GENE is real           (IMGT: F / ORF / P)
#   --min-len/--max-len  junction_aa length, INCLUSIVE     (default sanity bound 5..60)
# A productive rearrangement can still use a pseudogene V — filtering one says nothing
# about the other.
vdjtools filter clones.parquet --productive --min-freq 1e-4 -o productive.tsv
vdjtools filter clones.parquet --nonproductive -o nonproductive.tsv   # isolate them instead
vdjtools filter clones.parquet --functional-genes --keep-orf -o f_orf.tsv
vdjtools filter clones.parquet --productive --keep-frequencies -o kept.tsv  # file's own freqs

# cross-batch V/J-usage bias — correct the usage, and rewrite the clonotype tables
vdjtools correct-vj s1.tsv s2.tsv s3.tsv s4.tsv -b A,A,B,B \
    --transform sigmoid --usage-out usage.tsv --outdir corrected/

vdjtools pool s1.tsv s2.tsv s3.tsv --join --min-samples 2 -o joint.tsv

# repertoire analytics — sample files, or a cohort via -m/--metadata + --base-dir
vdjtools diversity      sampleA.tsv sampleB.tsv -o diversity.tsv
vdjtools overlap        *.tsv -o overlap.tsv
vdjtools segment-usage  *.tsv --segment v -o usage.tsv
vdjtools spectratype    *.tsv -o spectra.tsv
vdjtools diversity      -m metadata.txt --base-dir samples/ --threads 8 -o div.tsv   # parallel cohort
vdjtools spectratype    --cohort cohort_parquet/ -o spectra.tsv                       # one streamed pass

# the portable signature — one fixed, named feature vector per sample (see below)
vdjtools corpus         --corpus naive --smoke -o naive.npz      # fit once, no cohort needed
vdjtools signature      --corpus naive.npz -m metadata.txt --base-dir samples/ -o sig.tsv

# longitudinal — paired within-donor expansion test between two timepoints
vdjtools dynamics day0.tsv day15.tsv -o tracked.tsv

Native vdjtools, AIRR Rearrangement, Parquet, and third-party inputs are auto-detected; every command writes to -o — TSV, or Parquet when the path ends in .parquet / .pq — or to stdout (so it pipes). Cohort commands parallelise over samples with -t/--threads or stream a pre-ingested Parquet cohort with --cohort. Run vdjtools <command> --help for options.

Analytics (Python API)

Every reader returns one canonical polars clonotype frame (AIRR junction columns), and every analysis function takes and returns such frames — so results chain together and drop straight into plotting. A tour of the analysis modules (full runnable walkthrough in the User guide):

from vdjtools import io as vio, stats, features, overlap, preprocess

# load (auto-detects MiXcr / immunoSEQ / AIRR / native / … and converts), or a whole cohort:
sample = vio.read("clones.tsv")
cohort = vio.read_samples(vio.read_metadata("metadata.txt"), base_dir="samples/")

# diversity, rarefaction, segment usage, spectratype
stats.diversity_stats(sample)                 # observed, Chao1, Shannon, inverse-Simpson, d50, …
stats.inext(sample, q=(0, 1, 2))              # Hill-number rarefaction/extrapolation + bootstrap CIs
stats.segment_usage(sample, "v")              # V (or "j") usage;  stats.spectratype(sample)

# CDR3 physicochemistry & k-mers
features.physchem_profile(sample, region="all")

# repertoire overlap & TCRnet (fuzzy/similarity/TCRnet via the [overlap] engine)
overlap.overlap_metrics(sampleA, sampleB)     # F / D / Jaccard / Morisita-Horn …
overlap.tcrnet(sample)                         # per-clonotype neighbourhood enrichment

# preprocessing: downsample to a common depth, error-correct, filter, pool
preprocess.downsample(sample, 100_000)
preprocess.correct(preprocess.filter_productive(sample))

# three filtering axes, kept apart: AIRR productivity, IMGT gene functionality, length
preprocess.filter_productive(sample, recompute_frequencies=False)  # keep the file's freqs
preprocess.filter_functional_genes(sample, keep=("F", "ORF"))      # IMGT axis
preprocess.filter_length(sample, min_len=5, max_len=60)            # inclusive bounds

# cross-batch V/J-usage bias: batch-correct usage, then resample the clonotype table
usage = preprocess.correct_vj_usage(cohort, batch_col="batch", transform="sigmoid")
fixed = preprocess.apply_vj_correction(sampleA, usage, sample_id="A0")

The portable signature — one repertoire in, a fixed named positional feature vector out, on a scale a downstream model can consume without fitting a scaler of its own. This is the statistics half (vsig); the geometry half (rsig, features of the prototype-sum embedding) is mirpy's mir.signature, and the two concatenate on sample_id into one contract:

from vdjtools.signature import vsig, vsig_cohort
from vdjtools.signature.corpus import Corpus

corpus = Corpus.load("naive.npz")             # a corpus is REQUIRED -- no default
v = vsig({"TRB": sample}, corpus)             # {column: value}, in artifact order

Every feature carries a variance-stabilising transform chosen from its support — Haldane–Anscombe logit for a proportion, Anscombe arcsine for a share, CLR (k−1 parts) for a composition, log for a count — so that a read count, an isotype fraction and a principal component can sit in one matrix. core ⊂ standard ⊂ full are exact index subsets of one frozen column order. A locus that was not sequenced is nan plus a mask: column, never a zero.

Longitudinal tracking — which clonotypes changed between two timepoints, and the VDJtrack recapture model (Pavlova, Zvyagin & Shugay 2024):

from vdjtools import dynamics

# paired within-donor test: emergent / expanded / persistent / contracted / vanishing
tracked = dynamics.test_pair(day0, day15)                  # depth handled per-pair (effective N)
grouped = dynamics.test_metaclonotypes(day0, day15, scope="1,0,0,1")  # 1-Hamming CDR3 ball first
called  = dynamics.expansion_test(day0, day15)             # edgeR NB-exact caller (log2FC + p)

# VDJtrack size-bucket recapture model — recapture fraction per clone-size class (Beta bands);
# split by a group column + capture_test() for the group effect (see examples/vaccination_tracking.py)
rates = dynamics.capture_rates(pre, post)

Incidence-based clonotype association (Emerson 2017 / Howie 2015 / De Witt 2018 / Vlasova 2026) — a choice of test, condition, and co-occurrence — and single-cell paired-chain Pgen:

from vdjtools import biomarker, sc
from vdjtools.biomarker import association, condition

# feature vs condition: Fisher / chi2 / Bayesian / permutation; binary, per-HLA-allele, or CMH-stratified
association(cohort, condition.binary(meta, "cmv"), test=["fisher", "bayes_bf"])
association(cohort, condition.stratified(meta, "cmv", "hla"), stratum_col="_stratum")  # CMV | HLA (CMH)

# feature vs feature: in-silico α-β pairing / same-chain co-specificity (θ lift + Fisher + FDR)
biomarker.cooccurrence(cohort, chain_a="TRA", chain_b="TRB", evalue=True)

sc.paired_pgen(sc.pair_chains(sc.read_10x("filtered_contig_annotations.csv")))  # pgen_alpha·pgen_beta

Repertoire signatures (extended)

An optional layer on top of the analytics above, for when the question is a model rather than a statistic: one AIRR sample in, one fixed-width, named, already-standardised feature vector out — so your matrix and a collaborator's are the same coordinate system, computed independently, with no scaler of your own.

vdjtools corpus --corpus naive --smoke -o naive.npz          # build a corpus (no cohort needed)
vdjtools signature --corpus naive.npz -m metadata.txt --base-dir samples/ -o vsig.tsv
vdjtools signature --corpus naive.npz --components 32 --describe   # exactly what you will get

from vdjtools.signature import vsig, vsig_cohort, raw_and_channels, synthesize

Three stages, and a corpus fixes the last two: raw features come from this sample alone, then they are clamped to the corpus's winsorization bounds, then rotated by its per-locus PCA and scaled by its per-PC median and MAD. A corpus is required — a signature is comparable to another one only if both were rotated through the same one, and nothing about the numbers would say otherwise.

Columns are <sig>:<block>:<locus>:<feature>. What comes out per locus is vsig:pc:<locus>:PCnn plus channels, which are never rotated and never clamped: cov:*:cstar (the coverage this sample actually attained, always emitted), mask:* (why a column is a hole), and qc:* (germline fallback fractions, and how much of the row the bounds clamped). A hole is nan, never 0.

--components takes a count (128) or a variance fraction (0.95); truncating downward later is exact and needs no refit.

This command emits the statistics half (vsig). The geometry half (rsig) needs the prototype embedding and lives in mirpy — mir signature emits it.

Full documentation, including which corpus to use and how the winsorization side is chosen: Signature · Channels

Recombination model engine

Precomputed models for all 7 human loci ship in the wheel — no OLGA or download needed:

from vdjtools.model import load_bundled, native
from vdjtools.model.generate import generate

model = load_bundled("TRB", source="olga")     # or source="learned" (fit to real repertoires)

native.pgen_nt(model, "TGTGCCAGCAGC...")        # nucleotide generation probability (native C++)
native.pgen_aa(model, "CASSLAPGATNEKLFF")       # amino-acid Pgen (codon-marginalised)
native.pgen_aa(model, "CASSLAPGATNEKLFF", mismatches=1)   # + the whole Hamming-1 ball
native.pgen_aa_batch(model, seqs, mismatches=1, threads=0)  # Pgen over many CDR3s, thread-parallel (~11×)
generate(model, 1000, seed=1)                    # sample a repertoire -> polars DataFrame
                                                # seed= is process-stable from 3.3.0

Where Pgen sums over recombination scenarios, model.viterbi takes the argmax — the single most likely one, which is the V/D/J boundary markup:

from vdjtools.model import best_scenario

sc = best_scenario(model, "TGTGCCAGCAGCTTAGGGACAGGGGGCTACGAGCAGTACTTC",
                   v="TRBV19*01", j="TRBJ2-7*01")     # ALLELE names, as the model's tables are

sc.v_end, sc.d_call, sc.d_start, sc.d_end, sc.j_start   # 0-based, half-open, in CDR3-nt space
# -> 8, 'TRBD1*01', 15, 24, 26

It reuses the same tables and the same loops as pgen_nt, so the chosen D obeys P(D|J) — a TRBD2–TRBJ1 pair is genomically impossible and cannot be called.

infer_nt goes the other way, reconstructing a nucleotide CDR3 from an amino-acid one — the VDJdb case, where a record carries (V, J, CDR3aa) and no nucleotides:

from vdjtools.model import infer_nt

sc = infer_nt(model, "CASSLGQAYEQYF", v="TRBV5-1*01", j="TRBJ2-3*01")
sc.cdr3_nt, sc.pgen, sc.margin        # sequence, its exact Pgen, and how far ahead of the runner-up

Germline positions are pinned to their segment; each free N-region position takes the nucleotide the insertion model prefers. It reproduces the exponential brute-force oracle exactly on every record the oracle can resolve (25/25 TRG, 19/19 TRA) — fixing the germline trim first and then picking the best codon per residue only manages 9/25 and 4/19, because a trim chosen before the codons pins a codon the true optimum would have trimmed away.

The search is native (the same Pi_L·Pi_R transfer matrix as pgen_aa, with max for the sums): 2.5 ms per human TRB CDR3, 0.5 ms per TRA — all 80k VDJdb records in about 3 minutes. v=/j= take one allele, several (a list or the comma-separated string an ambiguous v_call carries), or nothing at all, in which case the DP marginalizes over every gene at essentially no extra cost.

Matches OLGA's Pgen to machine precision across all 7 loci, and adds tandem-D (D-D) support that OLGA/IGoR lack. Learn a model from your own non-functional reads (out-of-frame or stop-codon — both escaped selection, which is all a generative model needs) with model.infer.infer_native.

Explore any model's recombination Bayes net interactively (entropy, mutual information, marginals):

pip install "vdjtools[examples]"
marimo edit examples/model_explorer.py

Interactive marimo notebooks (data auto-loads from HuggingFace, or a local ~/hf/ copy):

• examples/vaccination_tracking.py — clonotype tracking + the recapture model across yellow-fever / influenza / TBE vaccination time courses (vdjtools.dynamics).
• examples/aging.py — cohort-streaming diversity, clone-size and spectratype vs age.
• examples/ankspond_motif.py — the ankylosing-spondylitis TRBV9 "AS27" motif: disease vs HLA-B27 carriage.
• examples/biomarker_explorer.py — Emerson public-TCR association + co-occurrence.

Performance

The Pgen / generation / EM / diversity hot paths are a native C++ (pybind11) core; everything else is polars. Amino-acid Pgen matches OLGA to machine precision (1e-15) across all 7 loci while being several times faster, and the built-in models keep the resident set small. Single thread, Apple M3 (arm64), bundled human TRB model:

Nucleotide Pgen (via the same transfer-matrix DP as the aa path — an in-frame CDR3 is an aa query with one codon fixed per position) is exact vs OLGA across all loci. Batched Pgen / 1-mismatch over many CDR3s parallelises over sequences (native.pgen_aa_batch, ~11× on 16 cores, bitwise-identical to the serial result); the EM E-step parallelises over reads (~6.7× on 8 threads); diversity/rarefaction run on a native iNEXT kernel (bootstrap + parallel batch). Memory stays light — ~63 MB resident for import vdjtools plus one loaded model, ~123 MB with all seven bundled models resident. Reproduce the in-repo half with RUN_BENCHMARK=1 pytest tests/python -k benchmark; the standalone Pgen harness lives in the separate 2026-vdjtools-benchmark repository.

Capabilities

Reference: the User guide walks through every module with runnable examples; the API reference documents every symbol.

• IO — canonical clonotype frame on AIRR junction columns (junction_nt / junction_aa); readers for native vdjtools, AIRR Rearrangement TSV, and Parquet, plus format-detecting converters for MiXcr (v1/2 + v3/4, incl. C-gene / BCR isotype), MiGec, Adaptive immunoSEQ (v1/v2), IMGT/HighV-QUEST, Vidjil, RTCR, TRUST4, and arda AIRR output (vdjtools.io.convert); metadata-driven batch + hive-partitioned cohorts.

• Model — native V(D)J recombination model: generation probability (Pgen — nt, aa, 1-mismatch, V/J-agnostic, thread-parallel batch), sequence generation, and EM inference, all in a native (pybind11) core. Supersedes OLGA and IGoR: arda-driven scenario enumeration, polars marginal tables, read-parallelised EM, and tandem-D (D-D) support. Concordant with OLGA across all 7 loci; precomputed OLGA + real-data-learned models bundled (load_bundled).

• Model workshop (user guide) — build a model on your own V(D)J germline library (from_germline, FASTA + anchors) and fit it to your own sequences; export and re-import every marginal as tables; check a model against its germline (check_model — functional genes stuck at P=0, unreachable deletion mass, incomplete conditionals); read the EM training log and per-iteration likelihood; compare two models (per-event Jensen-Shannon / total variation, gene usage, a bnlearn-style comparison graph) and their Pgen distributions; compute log-likelihood, AIC and BIC of a clonotype set under a model; fine-tune it, extend it with a larger allele library, and re-weight V/J usage for protocol bias. Plus information content per recombination event and a total diversity estimate (human TRB: ~52 bits per rearrangement, ~45 bits per sequence, ~3·10¹³ effective sequences).

• Stats — diversity (Chao1/Shannon/Simpson/…), spectratype, V/J/VJ usage.

• Features — CDR physicochemical profiles, k-mer / V+k-mer summaries.

• Overlap — sample overlap and TCRnet (via vdjmatch/seqtree), similarity-aware overlap, clustering.

• Preprocess — downsampling, error-correction, VJ-usage batch-effect correction, pooling/joining.

• Biomarker — incidence association (Fisher / χ² / Bayesian / permutation) against binary, per-HLA-allele or CMH-stratified conditions; α-β and same-chain co-occurrence pairing; metaclonotypes.

• Dynamics — longitudinal clonotype tracking between timepoints: the paired within-donor expansion test (emergent / expanded / persistent / contracted / vanishing), the VDJtrack size-bucket recapture model, metaclonotype-grouped testing, and an edgeR NB-exact caller (vdjtools.dynamics).

• Single-cell — CellRanger / AIRR Cell / arda ingestion, chain pairing + doublet & mispairing QC, paired α/β Pgen, clustering evaluation, and round-trip interop with the downstream single-cell stack (vdjtools.sc, guide).

  Ecosystem	Out	Back in	Needs
  scirpy / scverse	to_scirpy (scirpy's obsm["airr"], or a MuData with GEX)	from_scirpy	scirpy out; only awkward back
  dandelion	to_dandelion	from_dandelion, read_h5ddl	sc-dandelion out; only h5py back
  scRepertoire (R)	write_screpertoire (AIRR or 10x shaped)	—	nothing
  Any AIRR consumer	to_airr / write_airr	from_airr, read_airr_cell	nothing

  All four read the same thing — a flat AIRR Rearrangement table with sequence_id + cell_id — so there is one emitter and one inverse, and each bridge is a thin adapter. Writing a container delegates to the library that owns it (no stale copy of someone else's schema to drift); reading one is ours, so a result handed to you is always openable. push_obs pushes a vdjtools-computed column (pgen_paired, mispairing flags) onto an AnnData.obs or Dandelion.metadata you did not build. CLI: vdjtools sc convert|pair|qc|pgen|export.

License

GPL-3.0-or-later.