DNA analyser API wrapper tool for Jupiter notebooks.
Project description
DNA analyser IBP
Tool for creating palindrome, p53, and G-quadruplex analysis. Work as API wrapper for IBP DNA analyzer API bioinformatics.ibp. Currently working with localhost instance of DNA analyser server working on http://bioinformatics.ibp.cz computational core but can be switched to local instance of server.
Getting Started
Prerequisites
python >= 3.6
Dependencies
- requests >= 2.20
- requests-toolbelt >= 0.9.1
- pyjwt >= 1.7.1
- pandas >= 0.23
- matplotlib >= 3.0.3
- tqdm >= 4.28
Features
- g4hunter analyser - version 1.0
- g4killer analyser - version 1.1
- g4hunter heatmap - version 1.3
- p53 predictor tool - version 1.4
- new documentation minor fixes + refactoring - version 1.5.1
- change in analyses tagging (default=sequence_tags) - version 1.5.2
- GC counter in sequence tables, progress status works with batch - version 1.5.3
- Bug fix (batch) - version 1.5.4
- Add nucleic-count tool for re-counting feature - version 1.5.5
- palindrome analyser
- feature map overlaping
Installing
To install test version from Pypi.
pipenv install dna-analyser-ibp
pip install dna-analyser-ibp
Quick start
DNA analyser uses pandas dataframe
or pandas series
. Firstly the user has to create Api
object and login to API.
from DNA_analyser_IBP.api import Api
API = Api(server='http://bioinformatics.ibp.cz:8888/api')
Enter your email example@example.cz
Enter your password ········
User user@mendelu.cz logged in: 2019-03-27 19:46:56.661376
If DNA analyser API server not running on http://bioinformatics.ibp.cz then use this example to create Api
object.
from DNA_analyser_IBP.api import Api
API = Api(server='http://hostname:port/api')
Then upload NCBI sequence for example Homo sapiens chromosome 12
use.
API.sequence.ncbi_creator(circular= True, tags=['Homo','sapiens', 'chromosome'], name='Homo sapiens chromosome 12', ncbi_id='NC_000012.12')
To analyse NCBI sequence use g4hunter interface.
sapiens_sequence = API.sequence.load_all(filter_tag='Homo') # get series with sapiens sequence
# run g4hunter analyses with these params
API.g4hunter.analyse_creator(sequence=sapiens_sequence, tags=['testovaci','Homo', 'sapiens'], threshold=1.4, window_size=30)
Last step to see results of g4hunter analysis.
sapiens = API.g4hunter.load_all(filter_tag=['Homo']) # returns dataframe
API.g4hunter.load_results(g4hunter_analyse=sapiens.iloc[0]) # iloc[0] to select row from dataframe
P53 / G4KILLER TOOL
To run simple tools using plain text input.
# implements g4killer algorithm for generating sequence with lower gscore
API.g4killer.run_tool(origin_sequence='AATTATTTGGAAAGGGGGGGTTTTCCGA', threshold=0.5)
# implements calculations of p53 binding predictor for 20 base pairs sequences
API.p53.run_tool(sequence='GGACATGCCCGGGCATGTCC')
Tests
To run tests only when downloaded directly from this repository.
pytest -v tests/
Authors
- Patrik Kaura - Main developer - patrikkaura
- Jan Kolomaznik - Supervisor - jankolomaznik
License
This project is licensed under the GPL-3.0 License - see the LICENSE.md file for details
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.