This release is a pre-release and may not be stable for production use.
vrs-python
VRS-Python provides Python language support and a reference implementation for the GA4GH Variation Representation Specification(VRS).
Information
Releases
Development
Features
- Pydantic implementation of GKS core models and VRS models
- Algorithm for generating consistent, globally unique identifiers for variation without a central authority
- Algorithm for performing fully justified allele normalization
- Translating from and to other variant formats
- Annotate VCFs with VRS
- Convert GA4GH objects between inlined and referenced forms
Known Issues
You are encouraged to browse issues. All known issues are listed there. Please report any issues you find.
Installing VRS-Python Locally
Prerequisites
- Python >= 3.10
- Note: Python 3.12 is required for developers contributing to VRS-Python. The
Makefile sets up a virtual environment in
venv/3.12and expects Python to be available aspython3.12.
- Note: Python 3.12 is required for developers contributing to VRS-Python. The
Makefile sets up a virtual environment in
- libpq
- postgresql
MacOS
You can use Homebrew to install the prerequisites. See the
Homebrew documentation for how to install. Make
sure Homebrew is up-to-date by running brew update.
brew install libpq
brew install python3
brew install postgresql@14
Ubuntu
sudo apt install gcc libpq-dev python3-dev
Installation Steps
1. Install VRS-Python with pip
VRS-Python is available on PyPI.
pip install 'ga4gh.vrs[extras]'
The [extras] argument tells pip to install packages to fulfill the dependencies of the
ga4gh.vrs.extras package.
2. Install External Data Sources
The ga4gh.vrs.extras modules are not part of the VR spec per se. They are
bundled with ga4gh.vrs for development and installation convenience. These
modules depend directly and indirectly on external data sources of sequences,
transcripts, and genome-transcript alignments.
First, you must install a local SeqRepo:
pip install biocommons.seqrepo
export SEQREPO_VERSION=2024-12-20 # or newer if available -- check `seqrepo list-remote-instances`
sudo mkdir -p /usr/local/share/seqrepo
sudo chown $USER /usr/local/share/seqrepo
seqrepo pull -i $SEQREPO_VERSION
seqrepo update-latest
If you encounter a permission error similar to the one below:
PermissionError: [Error 13] Permission denied: '/usr/local/share/seqrepo/2024-12-20._fkuefgd' -> '/usr/local/share/seqrepo/2024-12-20'
Try moving data manually with sudo:
sudo mv /usr/local/share/seqrepo/$SEQREPO_VERSION.* /usr/local/share/seqrepo/$SEQREPO_VERSION
To make installation easy, we recommend using Docker to install the other Biocommons tools - SeqRepo REST and UTA. If you would like to use local instances of UTA, see UTA directly. We do provide some additional setup help here.
Next, run the following commands:
docker volume create --name=uta_vol
docker volume create --name=seqrepo_vol
docker compose up
[!NOTE] You must run all Docker commands from the root of the vrs-python repository (where
docker-compose.ymllives). See installing for development for the clone commands. If you use Docker Compose v1, usedocker-composeinstead ofdocker compose. However, we do recommend upgrading to v2.
This should start three containers:
- seqrepo: downloads seqrepo into a docker volume and exits
- seqrepo-rest-service: a REST service on seqrepo (localhost:5000)
- uta: a database of transcripts and alignments (localhost:5432)
Check that the seqrepo-rest-service and uta containers are running, by running:
$ docker ps
CONTAINER ID IMAGE // NAMES
86e872ab0c69 biocommons/seqrepo-rest-service:latest // vrs-python_seqrepo-rest-service_1
a40576b8cf1f biocommons/uta:uta_20241220 // vrs-python_uta_1
Depending on your network and host, the first run is likely to take 5-15 minutes in order to download and install data. Subsequent startups should be nearly instantaneous.
You can test UTA and seqrepo installations like so:
$ psql -XAt postgres://anonymous@localhost/uta -c 'select count(*) from uta_20241220.transcript'
314227
curl 'http://127.0.0.1:5000/seqrepo/1/sequence/refseq:NM_000059.4?end=20'
AGAGGCGGAGCCGCTGTGGC
It doesn't work
Here are some things to try.
-
Bring up one service at a time. For example, if you haven't download seqrepo yet, you might see this:
$ docker compose up seqrepo-rest-service Starting vrs-python_seqrepo-rest-service_1 ... done Attaching to vrs-python_seqrepo-rest-service_1 seqrepo-rest-service_1 | 2022-07-26 15:59:59 seqrepo_rest_service.__main__[1] INFO Using seqrepo_dir='/usr/local/share/seqrepo/2024-12-20' from command line ⋮ seqrepo-rest-service_1 | OSError: Unable to open SeqRepo directory /usr/local/share/seqrepo/2024-12-20 vrs-python_seqrepo-rest-service_1 exited with code 1
-
If you are having issues with UTA: if your machine is already running postgresql on port 5432 (which is the default on many systems), you may see an error message such as this:
$ psql -XAt postgres://anonymous@localhost/uta -c 'select count(*) from uta_20241220.transcript' psql: error: connection to server at "localhost" (::1), port 5432 failed: FATAL: role "anonymous" does not exist
You can move your UTA installation to a different port as follows:
- Select a new port number for UTA, and verify that the port is available.
For example, if you have sudo privileges on your machine, you can verify
the port is available with the
lsofcommand:
If the port is available, the output of this command should be 0 lines long.sudo lsof -i :[port_number] - Edit your docker-compose.yml file. In the lines
replace the first number with a different number to specify a port on your local machine.ports: - 5432:5432ports: - [your_port_number]:5432 - Repeat the
docker compose upcommand - Repeat the command above to verify that there is now a docker command
listening at this port.
This time, you should see that a docker command is using the port.sudo lsof -i :[your_port_number] - Specify the new port in your psql command:
$ psql -XAt postgres://anonymous@localhost/uta -p [your_port_number] -c 'select count(*) from uta_20241220.transcript'
- Set the
UTA_DB_URLenvironment variable to specify your port.export UTA_DB_URL="postgresql://anonymous@localhost:[your_port_number]/uta/uta_20241220"
- Select a new port number for UTA, and verify that the port is available.
For example, if you have sudo privileges on your machine, you can verify
the port is available with the
-
If you are having issues with SeqRepo, check to see if there is another process using port 5000, and try moving to a different port:
- Follow the instructions above to see if port 5000 is already in use.
- If it is, edit your docker-compose.yml file to specify a different port.
In the lines
replace the first number with a different number to specify a port on your local machine.ports: - 5000:5000ports: - [your_port_number]:5000 - Repeat the
docker compose upcommand - Test the SeqRepo REST API service with this new port
curl 'http://127.0.0.1:[your_port_number]/seqrepo/1/sequence/refseq:NM_000059.4?end=20'
- Set the
GA4GH_VRS_DATAPROXY_URIenvironment variable to point to this UL:$ export GA4GH_VRS_DATAPROXY_URI=http://localhost:[your_port_number]/seqrepo $ export SEQREPO_URI=http://localhost:[your_port_number]
VRS-Python and VRS Version Correspondence
The ga4gh/vrs-python repo embeds the ga4gh/vrs repo as a git submodule for testing purposes. Each ga4gh.vrs package on PyPI embeds a particular version of VRS. The correspondences between the packages that are currently maintained may be summarized as:
| vrs-python branch | vrs-python tag/version | vrs branch | vrs version |
|---|---|---|---|
| main (default branch) | 2.x | 2.x | 2.x |
| 1.x | 0.8.x | 1.x | 1.x |
⚠ Note: Only 2.x branch is being actively maintained. The 1.x branch will only be maintained for bug fixes.
⚠ Developers: See the development section below for recommendations for using submodules gracefully (and without causing problems for others!).
Previous VRS-Python and VRS Version Correspondence
The correspondences between the packages that are no longer maintained may be summarized as:
| vrs-python branch | vrs-python tag/version | vrs branch | vrs version |
|---|---|---|---|
| 0.9 | 0.9.x | metaschema-update | N/A |
| 0.7 | 0.7.x | 1.2 | 1.2.x |
| 0.6 | 0.6.x | 1.1 | 1.1.x |
Developers
This section is intended for developers who contribute to VRS-Python.
Installing for development
Then, clone your fork and initialize a development environment:
git clone --recurse-submodules git@github.com:YOUR_GITHUB_ID/vrs-python.git
cd vrs-python
make devready
source venv/3.12/bin/activate
This setup includes pre-commit hooks. If you create a virtual environment manually, be sure to install the hooks yourself; otherwise, commits may fail during CI/CD checks:
source venv/3.12/bin/activate
pre-commit install
If you already cloned the repo, but forgot to include --recurse-submodules you can run:
git submodule update --init --recursive
Submodules
vrs-python embeds vrs as a submodule, only for testing purposes. When checking out vrs-python and switching
branches, it is important to make sure that the submodule tracks vrs-python
correctly. The recommended way to do this is git config --global submodule.recurse true. If you don't set submodule.recurse, developers and
reviewers must be extremely careful to not accidentally upgrade or downgrade
schemas with respect to vrs-python.
Alternatively, see misc/githooks/.
Testing
This package implements typical unit tests for ga4gh.core and ga4gh.vrs. This package also implements the compliance tests from vrs (vrs/validation) in the tests/validation/ directory.
To run tests:
make test
Running the Notebooks
The notebooks do not require you to setup SeqRepo or UTA from Install External Data Sources.
Running the Notebooks on Binder
Binder allows you to create custom computing environments that can be shared and used by many remote users.
You can access the notebooks on Binder here.
Running the Notebooks on the Terra platform
Terra is a cloud platform for biomedical research developed by the Broad Institute, Microsoft and Verily. The platform includes preconfigured environments that provide user-friendly access to various applications commonly used in bioinformatics, including Jupyter Notebooks.
We have created a public VRS-demo-notebooks workspace in Terra that contains the demo notebooks along with instructions for running them with minimal setup. To get started, see either the VRS-demo-notebooks workspace or the Terra.ipynb notebook in this repository.
Running the Notebooks with VS Code
VS Code is a code editor developed by Microsoft. It is lightweight, highly customizable, and supports a wide range of programming languages, with a robust extension system. You can download VS Code here.
- Open VS Code.
- Use Extensions view (Ctrl+Shift+X or ⌘+Shift+X) to install the Jupyter extension.
- Navigate to your vrs-python project folder and open it in VS Code.
- In a notebook, click
Select Kernelat the top right. Select the option where the path isvenv/3.12/bin/python3. See here for more information on managing Jupyter Kernels in VS Code. - After selecting the kernel you can now run the notebook.
Security Note (from the GA4GH Security Team)
A stand-alone security review has been performed on the specification itself. This implementation is offered as-is, and without any security guarantees. It will need an independent security review before it can be considered ready for use in security-critical applications. If you integrate this code into your application it is AT YOUR OWN RISK AND RESPONSIBILITY to arrange for a security audit.
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
Built Distribution
Filter files by name, interpreter, ABI, and platform.
If you're not sure about the file name format, learn more about wheel file names.
Copy a direct link to the current filters
File details
Details for the file ga4gh_vrs-2.4.0a2.tar.gz.
File metadata
- Download URL: ga4gh_vrs-2.4.0a2.tar.gz
- Upload date:
- Size: 16.6 MB
- Tags: Source
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/7.0.0 CPython/3.13.14
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
dcc866fb4efd4486dc4ee7ca0c2e5f655017d80291e41d1f713ca6ce5ee78878
|
|
| MD5 |
da1428af1c29ca389c63ecb5764f6248
|
|
| BLAKE2b-256 |
bafa80e2771db541cbd786fe5bb99c3f7b19ab51758397311acabedef2b4a5ed
|
Provenance
The following attestation bundles were made for ga4gh_vrs-2.4.0a2.tar.gz:
Publisher:
release.yml on ga4gh/vrs-python
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
ga4gh_vrs-2.4.0a2.tar.gz -
Subject digest:
dcc866fb4efd4486dc4ee7ca0c2e5f655017d80291e41d1f713ca6ce5ee78878 - Sigstore transparency entry: 2437075897
- Sigstore integration time:
-
Permalink:
ga4gh/vrs-python@053fa2e04216f460969e85257d1a023f098fc992 -
Branch / Tag:
refs/tags/2.4.0-a2 - Owner: https://github.com/ga4gh
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
release.yml@053fa2e04216f460969e85257d1a023f098fc992 -
Trigger Event:
push
-
Statement type:
File details
Details for the file ga4gh_vrs-2.4.0a2-py3-none-any.whl.
File metadata
- Download URL: ga4gh_vrs-2.4.0a2-py3-none-any.whl
- Upload date:
- Size: 65.3 kB
- Tags: Python 3
- Uploaded using Trusted Publishing? Yes
- Uploaded via:
twine/7.0.0 CPython/3.13.14
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
71700c883d5c6389fcfd6c430057e7414bed07d18d72939db313caa0bcec23cb
|
|
| MD5 |
32a1524dd92aca186a7adf75b8ee5ca8
|
|
| BLAKE2b-256 |
64e34f0ef2488dfabd1053a5cdbdee042da729ed7a16d9029ce33b1e59f69bac
|
Provenance
The following attestation bundles were made for ga4gh_vrs-2.4.0a2-py3-none-any.whl:
Publisher:
release.yml on ga4gh/vrs-python
-
Statement:
-
Statement type:
https://in-toto.io/Statement/v1 -
Predicate type:
https://docs.pypi.org/attestations/publish/v1 -
Subject name:
ga4gh_vrs-2.4.0a2-py3-none-any.whl -
Subject digest:
71700c883d5c6389fcfd6c430057e7414bed07d18d72939db313caa0bcec23cb - Sigstore transparency entry: 2437076058
- Sigstore integration time:
-
Permalink:
ga4gh/vrs-python@053fa2e04216f460969e85257d1a023f098fc992 -
Branch / Tag:
refs/tags/2.4.0-a2 - Owner: https://github.com/ga4gh
-
Access:
public
-
Token Issuer:
https://token.actions.githubusercontent.com -
Runner Environment:
github-hosted -
Publication workflow:
release.yml@053fa2e04216f460969e85257d1a023f098fc992 -
Trigger Event:
push
-
Statement type: