Skip to main content

pyfaidx: efficient pythonic random access to fasta subsequences

Project description

|Travis| |PyPI|

Please cite `Shirley, Matthew (2014): pyfaidx: efficient pythonic random
access to fasta subsequences. figshare. DOI:10.6084/m9.figshare.972933`__.

.. __: http://dx.doi.org/10.6084/m9.figshare.972933


Description
-----------

Samtools provides a function "faidx" (FAsta InDeX), which creates a
small flat index file ".fai" allowing for fast random access to any
subsequence in the indexed fasta, while loading a minimal amount of the
file in to memory.

Installation
------------

This package is tested under Python 3.4, 3.3, 2.7, 2.6, and pypy.

::

pip install pyfaidx

or

python setup.py install

CLI Usage
---------

::

usage: faidx [-h] [-b BED] [-n] [--default_seq DEFAULT_SEQ] [--lazy]
[--complement] [--reverse]
fasta [regions [regions ...]]

Fetch sequence from faidx-indexed FASTA

positional arguments:
fasta FASTA file
regions space separated regions of sequence to fetch e.g.
chr1:1-1000

optional arguments:
-h, --help show this help message and exit
-b BED, --bed BED bed file of regions
-n, --name print sequence names. default: True
--default_seq DEFAULT_SEQ
default base for missing positions. default: N
--lazy lazy region bounds checking - fill in default_seq for
missing ranges. default: False
--complement comlement the sequence. default: False
--reverse reverse the sequence. default: False

Pyfaidx provides an interface for creating and using this index for fast
random access of **DNA** subsequences from huge fasta files in a
"pythonic" manner. Indexing speed is comparable to samtools, and in some
cases sequence retrieval is much faster (benchmark_). For example:

.. _benchmark: http://www.biostars.org/p/93364/#93390

.. code:: python

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> genes
Fasta("tests/data/genes.fasta") # set strict_bounds=True for bounds checking

Acts like a dictionary.

.. code:: python

>>> genes.keys() ['NR_104215.1',
'KF435150.1', 'NM_001282548.1', 'NM_001282549.1', 'XM_005249644.1',
'NM_001282543.1', 'NR_104216.1', 'XM_005265508.1', 'XR_241079.1',
'AB821309.1', 'XM_005249645.1', 'XR_241081.1', 'XM_005249643.1',
'XM_005249642.1', 'NM_001282545.1', 'NR_104212.1', 'XR_241080.1',
'XM_005265507.1', 'KF435149.1', 'NM_000465.3']

>>> genes['NM_001282543.1'][200:230]
>NM_001282543.1:201-230
CTCGTTCCGCGCCCGCCATGGAACCGGATG

>>> genes['NM_001282543.1'][200:230].seq
'CTCGTTCCGCGCCCGCCATGGAACCGGATG'

>>> genes['NM_001282543.1'][200:230].name
'NM_001282543.1:201-230'

>>> genes['NM_001282543.1'][200:230].start
201

>>> genes['NM_001282543.1'][200:230].end
230

>>> len(genes['NM_001282543.1'])
5466

Slices just like a string:

.. code:: python

>>> genes['NM_001282543.1'][200:230][:10]
>NM_001282543.1:201-210
CTCGTTCCGC

>>> genes['NM_001282543.1'][200:230][::-1]
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

>>> genes['NM_001282543.1'][200:230][::3]
>NM_001282543.1:201-230
CGCCCCTACA

>>> genes['NM_001282543.1'][:]
>NM_001282543.1:1-5466
CCCCGCCCCT........

- Start and end coordinates are 0-based, just like Python.

Complements and reverse complements just like DNA

.. code:: python

>>> genes['NM_001282543.1'][200:230].complement
>NM_001282543.1 (complement):201-230
GAGCAAGGCGCGGGCGGTACCTTGGCCTAC

>>> genes['NM_001282543.1'][200:230].reverse
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

>>> -genes['NM_001282543.1'][200:230]
>NM_001282543.1 (complement):230-201
CATCCGGTTCCATGGCGGGCGCGGAACGAG

Custom key functions provide cleaner access:

.. code:: python

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
>>> genes.keys()
dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
>>> genes['NR_104212'][:10]
>NR_104212:1-10
CCCCGCCCCT

Or just get a Python string:

.. code:: python

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', as_raw=True)
>>> genes
Fasta("tests/data/genes.fasta", as_raw=True)

>>> genes['NM_001282543.1'][200:230]
CTCGTTCCGCGCCCGCCATGGAACCGGATG

It also provides a command-line script:

cli script: faidx
~~~~~~~~~~~~~~~~~

.. code:: shell

$ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
>NM_001282543.1
CTCGTTCCGC
>NM_001282543.1
GTAATTGTGTAAGTGACTGCA

$ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1
GAGCAAGGCG

$ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1
CGCCTTGCTC

$ faidx tests/data/genes.fasta NM_001282543.1
>NM_001282543.1
CCCCGCCCCT........

$ faidx tests/data/genes.fasta --list regions.txt
...

Similar syntax as ``samtools faidx``


A lower-level Faidx class is also available:

.. code:: python

>>> from pyfaidx import Faidx
>>> fa = Faidx('genes.fa') # can return str with as_raw=True
>>> fa.index
OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])

>>> fa.index['AB821309.1'].rlen
3510

fa.fetch('AB821309.1', 1, 10)
>AB821309.1:1-10
ATGGTCAGCT


- If the FASTA file is not indexed, when ``Faidx`` is initialized the
``build_index`` method will automatically run, and
the index will be written to "filename.fa.fai" with ``write_fai()``.
where "filename.fa" is the original FASTA file.
- Start and end coordinates are 1-based.


Changes
-------

*New in version 0.2.8*:

- Small internal refactoring

*New in version 0.2.7*:

- Faidx and Fasta `strict_bounds` bounds checking logic is more correct
- Fasta `default_seq` parameter now works
- CLI script `faidx` now takes a BED file for fetching regions from a fasta

*New in version 0.2.6*:

- Faidx no longer has `raw_index` attribute or `rebuild_index` method (reduce memory footprint)
- Faidx index memory usage decreased by 31-40%
- *.fai creation is streaming, performance increase for very large indices
- Possible speed regression when performing many small queries using `Fasta` class

*New in version 0.2.5*:

- Fasta and Faidx can take `default_seq` in addition to `as_raw`, `key_function`,
and `strict_bounds` parameters.
- Fixed issue `#20 <https://github.com/mdshw5/pyfaidx/issues/20>`__
- Faidx has attribute `raw_index` which is a list representing the fai file.
- Faidx has `rebuild_index` and `write_fai` functions for building and writing
`raw_index` to file.
- Extra test cases, and test cases against Biopython SeqIO

*New in version 0.2.4*:

- Faidx index order is stable and non-random

*New in version 0.2.3*:

- Fixed a bug affecting Python 2.6

*New in version 0.2.2*:

- `Fasta` can receive the `strict_bounds` argument

*New in version 0.2.1*:

- `FastaRecord` str attribute returns a string
- `Fasta` is now an iterator

*New in version 0.2.0*:

- `as_raw` keyword arg for `Faidx` and `Fasta` allows a simple string return type
- `__str__` method for `FastaRecord` returns entire contig sequence

*New in version 0.1.9*:

- line wrapping of ``faidx`` is set based on the wrapping of the indexed
fasta file
- added ``--reverse`` and ``--complement`` arguments to ``faidx``

*New in version 0.1.8*:

- ``key_function`` keyword argument to ``Fasta`` allows lookup based on function
output

Acknowledgements
----------------

This project is freely licensed by the author, `Matthew
Shirley <http://mattshirley.com>`__, and was completed under the
mentorship and financial support of Drs. `Sarah
Wheelan <http://sjwheelan.som.jhmi.edu>`__ and `Vasan
Yegnasubramanian <http://yegnalab.onc.jhmi.edu>`__ at the Sidney Kimmel
Comprehensive Cancer Center in the Department of Oncology.

.. |Travis| image:: https://travis-ci.org/mdshw5/pyfaidx.svg?branch=master
:target: https://travis-ci.org/mdshw5/pyfaidx

.. |PyPI| image:: https://img.shields.io/pypi/v/pyfaidx.svg?branch=master
:target: https://pypi.python.org/pypi/pyfaidx

Project details


Release history Release notifications | RSS feed

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pyfaidx-0.2.8.tar.gz (10.6 kB view details)

Uploaded Source

File details

Details for the file pyfaidx-0.2.8.tar.gz.

File metadata

  • Download URL: pyfaidx-0.2.8.tar.gz
  • Upload date:
  • Size: 10.6 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No

File hashes

Hashes for pyfaidx-0.2.8.tar.gz
Algorithm Hash digest
SHA256 c3370dee8c2747c30bce308eccbb05c30aa83751354b1e136bed9062282bf378
MD5 dabed8992207f68aa02e696acad1717d
BLAKE2b-256 8588481fe720ff6f7a648a3d36e575c9e24061b41906453ff45832aebed22792

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page