Skip to main content

pyfaidx: efficient pythonic random access to fasta subsequences

Project description

Travis PyPI Code Health

Description

Samtools provides a function “faidx” (FAsta InDeX), which creates a small flat index file “.fai” allowing for fast random access to any subsequence in the indexed fasta, while loading a minimal amount of the file in to memory.

Installation

This package is tested under Python 3.2-3.4, 2.7, 2.6, and pypy.

pip install pyfaidx

or

python setup.py install

Usage

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> genes
Fasta("tests/data/genes.fasta")  # set strict_bounds=True for bounds checking

Acts like a dictionary.

>>> genes.keys() ('AB821309.1', 'KF435150.1', 'KF435149.1', 'NR_104216.1', 'NR_104215.1', 'NR_104212.1', 'NM_001282545.1', 'NM_001282543.1', 'NM_000465.3', 'NM_001282549.1', 'NM_001282548.1', 'XM_005249645.1', 'XM_005249644.1', 'XM_005249643.1', 'XM_005249642.1', 'XM_005265508.1', 'XM_005265507.1', 'XR_241081.1', 'XR_241080.1', 'XR_241079.1')

>>> genes['NM_001282543.1'][200:230]
>NM_001282543.1:201-230
CTCGTTCCGCGCCCGCCATGGAACCGGATG

>>> genes['NM_001282543.1'][200:230].seq
'CTCGTTCCGCGCCCGCCATGGAACCGGATG'

>>> genes['NM_001282543.1'][200:230].name
'NM_001282543.1:201-230'

>>> genes['NM_001282543.1'][200:230].start
201

>>> genes['NM_001282543.1'][200:230].end
230

>>> len(genes['NM_001282543.1'])
5466

Indexes like a list:

>>> genes[0][:50]
>AB821309.1:1-50
ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAAC

Slices just like a string:

>>> genes['NM_001282543.1'][200:230][:10]
>NM_001282543.1:201-210
CTCGTTCCGC

>>> genes['NM_001282543.1'][200:230][::-1]
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

>>> genes['NM_001282543.1'][200:230][::3]
>NM_001282543.1:201-230
CGCCCCTACA

>>> genes['NM_001282543.1'][:]
>NM_001282543.1:1-5466
CCCCGCCCCT........
  • Start and end coordinates are 0-based, just like Python.

Sequence can be buffered in memory using a read-ahead buffer:

>>> genes = Fasta('tests/data/genes.fasta' read_ahead=100)

>>> genes['NM_001282543.1'][200:230][::-1]
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

>>> len(genes.buffer)
100

Complements and reverse complements just like DNA

>>> genes['NM_001282543.1'][200:230].complement
>NM_001282543.1 (complement):201-230
GAGCAAGGCGCGGGCGGTACCTTGGCCTAC

>>> genes['NM_001282543.1'][200:230].reverse
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC

>>> -genes['NM_001282543.1'][200:230]
>NM_001282543.1 (complement):230-201
CATCCGGTTCCATGGCGGGCGCGGAACGAG

Custom key functions provide cleaner access:

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
>>> genes.keys()
dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
>>> genes['NR_104212'][:10]
>NR_104212:1-10
CCCCGCCCCT

Or just get a Python string:

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', as_raw=True)
>>> genes
Fasta("tests/data/genes.fasta", as_raw=True)

>>> genes['NM_001282543.1'][200:230]
CTCGTTCCGCGCCCGCCATGGAACCGGATG

You can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:

>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> for line in genes['NM_001282543.1']:
...   print(line)
CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
CGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGC
...

If you want to modify the contents of your FASTA file in-place, you can use the mutable argument. Any portion of the FastaRecord can be replaced with an equivalent-length string. Warning: This will change the contents of your file immediately and permanently:

>>> genes = Fasta('tests/data/genes.fasta', mutable=True)
>>> type(genes['NM_001282543.1'])
<class 'pyfaidx.MutableFastaRecord'>

>>> genes['NM_001282543.1'][:10]
>NM_001282543.1:1-10
CCCCGCCCCT
>>> genes['NM_001282543.1'][:10] = 'NNNNNNNNNN'
>>> genes['NM_001282543.1'][:15]
>NM_001282543.1:1-15
NNNNNNNNNNCTGGC

It also provides a command-line script:

cli script: faidx

For usage type faidx -h.

$ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
>NM_001282543.1
CTCGTTCCGC
>NM_001282543.1
GTAATTGTGTAAGTGACTGCA

$ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1
GAGCAAGGCG

$ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1
CGCCTTGCTC

$ faidx tests/data/genes.fasta NM_001282543.1
>NM_001282543.1
CCCCGCCCCT........

$ faidx tests/data/genes.fasta --list regions.txt
...

Similar syntax as samtools faidx

A lower-level Faidx class is also available:

>>> from pyfaidx import Faidx
>>> fa = Faidx('genes.fa')  # can return str with as_raw=True
>>> fa.index
OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])

>>> fa.index['AB821309.1'].rlen
3510

fa.fetch('AB821309.1', 1, 10)
>AB821309.1:1-10
ATGGTCAGCT
  • If the FASTA file is not indexed, when Faidx is initialized the build_index method will automatically run, and the index will be written to “filename.fa.fai” with write_fai(). where “filename.fa” is the original FASTA file.

  • Start and end coordinates are 1-based.

Changes

New in version 0.3.1:

  • Fasta can now accept an integer index in addition to string keys.

New in version 0.3.0:

  • FastaRecord now works as a line-based iterator (#30)

  • Added MutableFastaRecord class that allows same-length in-place replacement for FASTA (#29)

New in version 0.2.9:

  • Added read-ahead buffer for fast sequential sequence access (#26)

  • Fixed a condition where as_raw parameter was not respected (#27)

New in version 0.2.8:

  • Small internal refactoring

New in version 0.2.7:

  • Faidx and Fasta strict_bounds bounds checking logic is more correct

  • Fasta default_seq parameter now works

  • CLI script faidx now takes a BED file for fetching regions from a fasta

New in version 0.2.6:

  • Faidx no longer has raw_index attribute or rebuild_index method (reduce memory footprint)

  • Faidx index memory usage decreased by 31-40%

  • .fai creation is streaming, performance increase for very large indices

  • Possible speed regression when performing many small queries using Fasta class

New in version 0.2.5:

  • Fasta and Faidx can take default_seq in addition to as_raw, key_function, and strict_bounds parameters.

  • Fixed issue #20

  • Faidx has attribute raw_index which is a list representing the fai file.

  • Faidx has rebuild_index and write_fai functions for building and writing raw_index to file.

  • Extra test cases, and test cases against Biopython SeqIO

New in version 0.2.4:

  • Faidx index order is stable and non-random

New in version 0.2.3:

  • Fixed a bug affecting Python 2.6

New in version 0.2.2:

  • Fasta can receive the strict_bounds argument

New in version 0.2.1:

  • FastaRecord str attribute returns a string

  • Fasta is now an iterator

New in version 0.2.0:

  • as_raw keyword arg for Faidx and Fasta allows a simple string return type

  • __str__ method for FastaRecord returns entire contig sequence

New in version 0.1.9:

  • line wrapping of faidx is set based on the wrapping of the indexed fasta file

  • added --reverse and --complement arguments to faidx

New in version 0.1.8:

  • key_function keyword argument to Fasta allows lookup based on function output

Acknowledgements

This project is freely licensed by the author, Matthew Shirley, and was completed under the mentorship and financial support of Drs. Sarah Wheelan and Vasan Yegnasubramanian at the Sidney Kimmel Comprehensive Cancer Center in the Department of Oncology.

Project details


Release history Release notifications | RSS feed

Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distribution

pyfaidx-0.3.0.tar.gz (15.6 kB view details)

Uploaded Source

File details

Details for the file pyfaidx-0.3.0.tar.gz.

File metadata

  • Download URL: pyfaidx-0.3.0.tar.gz
  • Upload date:
  • Size: 15.6 kB
  • Tags: Source
  • Uploaded using Trusted Publishing? No

File hashes

Hashes for pyfaidx-0.3.0.tar.gz
Algorithm Hash digest
SHA256 2642de9f0644369e2279a86a3abdde12bdb3efebe3f9206783f0c65a65e94d64
MD5 9112a0c198853111b214b62262b5f256
BLAKE2b-256 171d09255dc4e93a1987d72c3e66b2524e76d50cc539d98d7c3dc2884350c574

See more details on using hashes here.

Supported by

AWS Cloud computing and Security Sponsor Datadog Monitoring Depot Continuous Integration Fastly CDN Google Download Analytics Pingdom Monitoring Sentry Error logging StatusPage Status page