pyfaidx: efficient pythonic random access to fasta subsequences
Project description
Description
Samtools provides a function “faidx” (FAsta InDeX), which creates a small flat index file “.fai” allowing for fast random access to any subsequence in the indexed fasta, while loading a minimal amount of the file in to memory.
Installation
This package is tested under Python 3.2-3.4, 2.7, 2.6, and pypy.
pip install pyfaidx or python setup.py install
Usage
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> genes
Fasta("tests/data/genes.fasta") # set strict_bounds=True for bounds checking
Acts like a dictionary.
>>> genes.keys() ('AB821309.1', 'KF435150.1', 'KF435149.1', 'NR_104216.1', 'NR_104215.1', 'NR_104212.1', 'NM_001282545.1', 'NM_001282543.1', 'NM_000465.3', 'NM_001282549.1', 'NM_001282548.1', 'XM_005249645.1', 'XM_005249644.1', 'XM_005249643.1', 'XM_005249642.1', 'XM_005265508.1', 'XM_005265507.1', 'XR_241081.1', 'XR_241080.1', 'XR_241079.1')
>>> genes['NM_001282543.1'][200:230]
>NM_001282543.1:201-230
CTCGTTCCGCGCCCGCCATGGAACCGGATG
>>> genes['NM_001282543.1'][200:230].seq
'CTCGTTCCGCGCCCGCCATGGAACCGGATG'
>>> genes['NM_001282543.1'][200:230].name
'NM_001282543.1:201-230'
>>> genes['NM_001282543.1'][200:230].start
201
>>> genes['NM_001282543.1'][200:230].end
230
>>> len(genes['NM_001282543.1'])
5466
Indexes like a list:
>>> genes[0][:50]
>AB821309.1:1-50
ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAAC
Slices just like a string:
>>> genes['NM_001282543.1'][200:230][:10]
>NM_001282543.1:201-210
CTCGTTCCGC
>>> genes['NM_001282543.1'][200:230][::-1]
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
>>> genes['NM_001282543.1'][200:230][::3]
>NM_001282543.1:201-230
CGCCCCTACA
>>> genes['NM_001282543.1'][:]
>NM_001282543.1:1-5466
CCCCGCCCCT........
Start and end coordinates are 0-based, just like Python.
Sequence can be buffered in memory using a read-ahead buffer:
>>> genes = Fasta('tests/data/genes.fasta' read_ahead=100)
>>> genes['NM_001282543.1'][200:230][::-1]
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
>>> len(genes.buffer)
100
Complements and reverse complements just like DNA
>>> genes['NM_001282543.1'][200:230].complement
>NM_001282543.1 (complement):201-230
GAGCAAGGCGCGGGCGGTACCTTGGCCTAC
>>> genes['NM_001282543.1'][200:230].reverse
>NM_001282543.1:230-201
GTAGGCCAAGGTACCGCCCGCGCCTTGCTC
>>> -genes['NM_001282543.1'][200:230]
>NM_001282543.1 (complement):230-201
CATCCGGTTCCATGGCGGGCGCGGAACGAG
Custom key functions provide cleaner access:
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', key_function = lambda x: x.split('.')[0])
>>> genes.keys()
dict_keys(['NR_104212', 'NM_001282543', 'XM_005249644', 'XM_005249645', 'NR_104216', 'XM_005249643', 'NR_104215', 'KF435150', 'AB821309', 'NM_001282549', 'XR_241081', 'KF435149', 'XR_241079', 'NM_000465', 'XM_005265508', 'XR_241080', 'XM_005249642', 'NM_001282545', 'XM_005265507', 'NM_001282548'])
>>> genes['NR_104212'][:10]
>NR_104212:1-10
CCCCGCCCCT
Or just get a Python string:
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta', as_raw=True)
>>> genes
Fasta("tests/data/genes.fasta", as_raw=True)
>>> genes['NM_001282543.1'][200:230]
CTCGTTCCGCGCCCGCCATGGAACCGGATG
You can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:
>>> from pyfaidx import Fasta
>>> genes = Fasta('tests/data/genes.fasta')
>>> for line in genes['NM_001282543.1']:
... print(line)
CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
CGATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGC
...
If you want to modify the contents of your FASTA file in-place, you can use the mutable argument. Any portion of the FastaRecord can be replaced with an equivalent-length string. Warning: This will change the contents of your file immediately and permanently:
>>> genes = Fasta('tests/data/genes.fasta', mutable=True)
>>> type(genes['NM_001282543.1'])
<class 'pyfaidx.MutableFastaRecord'>
>>> genes['NM_001282543.1'][:10]
>NM_001282543.1:1-10
CCCCGCCCCT
>>> genes['NM_001282543.1'][:10] = 'NNNNNNNNNN'
>>> genes['NM_001282543.1'][:15]
>NM_001282543.1:1-15
NNNNNNNNNNCTGGC
It also provides a command-line script:
cli script: faidx
For usage type faidx -h.
$ faidx tests/data/genes.fasta NM_001282543.1:201-210 NM_001282543.1:300-320
>NM_001282543.1
CTCGTTCCGC
>NM_001282543.1
GTAATTGTGTAAGTGACTGCA
$ faidx --complement tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1
GAGCAAGGCG
$ faidx --reverse tests/data/genes.fasta NM_001282543.1:201-210
>NM_001282543.1
CGCCTTGCTC
$ faidx tests/data/genes.fasta NM_001282543.1
>NM_001282543.1
CCCCGCCCCT........
$ faidx tests/data/genes.fasta --list regions.txt
...
Similar syntax as samtools faidx
A lower-level Faidx class is also available:
>>> from pyfaidx import Faidx
>>> fa = Faidx('genes.fa') # can return str with as_raw=True
>>> fa.index
OrderedDict([('AB821309.1', IndexRecord(rlen=3510, offset=12, lenc=70, lenb=71)), ('KF435150.1', IndexRecord(rlen=481, offset=3585, lenc=70, lenb=71)),... ])
>>> fa.index['AB821309.1'].rlen
3510
fa.fetch('AB821309.1', 1, 10)
>AB821309.1:1-10
ATGGTCAGCT
If the FASTA file is not indexed, when Faidx is initialized the build_index method will automatically run, and the index will be written to “filename.fa.fai” with write_fai(). where “filename.fa” is the original FASTA file.
Start and end coordinates are 1-based.
Changes
New in version 0.3.1:
Fasta can now accept an integer index in addition to string keys.
New in version 0.3.0:
FastaRecord now works as a line-based iterator (#30)
Added MutableFastaRecord class that allows same-length in-place replacement for FASTA (#29)
New in version 0.2.9:
Added read-ahead buffer for fast sequential sequence access (#26)
Fixed a condition where as_raw parameter was not respected (#27)
New in version 0.2.8:
Small internal refactoring
New in version 0.2.7:
Faidx and Fasta strict_bounds bounds checking logic is more correct
Fasta default_seq parameter now works
CLI script faidx now takes a BED file for fetching regions from a fasta
New in version 0.2.6:
Faidx no longer has raw_index attribute or rebuild_index method (reduce memory footprint)
Faidx index memory usage decreased by 31-40%
.fai creation is streaming, performance increase for very large indices
Possible speed regression when performing many small queries using Fasta class
New in version 0.2.5:
Fasta and Faidx can take default_seq in addition to as_raw, key_function, and strict_bounds parameters.
Fixed issue #20
Faidx has attribute raw_index which is a list representing the fai file.
Faidx has rebuild_index and write_fai functions for building and writing raw_index to file.
Extra test cases, and test cases against Biopython SeqIO
New in version 0.2.4:
Faidx index order is stable and non-random
New in version 0.2.3:
Fixed a bug affecting Python 2.6
New in version 0.2.2:
Fasta can receive the strict_bounds argument
New in version 0.2.1:
FastaRecord str attribute returns a string
Fasta is now an iterator
New in version 0.2.0:
as_raw keyword arg for Faidx and Fasta allows a simple string return type
__str__ method for FastaRecord returns entire contig sequence
New in version 0.1.9:
line wrapping of faidx is set based on the wrapping of the indexed fasta file
added --reverse and --complement arguments to faidx
New in version 0.1.8:
key_function keyword argument to Fasta allows lookup based on function output
Acknowledgements
This project is freely licensed by the author, Matthew Shirley, and was completed under the mentorship and financial support of Drs. Sarah Wheelan and Vasan Yegnasubramanian at the Sidney Kimmel Comprehensive Cancer Center in the Department of Oncology.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
File details
Details for the file pyfaidx-0.3.1.tar.gz.
File metadata
- Download URL: pyfaidx-0.3.1.tar.gz
- Upload date:
- Size: 15.7 kB
- Tags: Source
- Uploaded using Trusted Publishing? No
File hashes
| Algorithm | Hash digest | |
|---|---|---|
| SHA256 |
d7d1ec68bbba8d92a01758e553eb37beeba34b677e546d1b84534e2248a6c622
|
|
| MD5 |
6dcaea2c3d334a605e44d9203e410504
|
|
| BLAKE2b-256 |
1467526750a2e36416dab90992568c7b002457910cf95699fb7a60fda3810cc4
|